Morpholino

MO1-dync2li1

ID

ZDB-MRPHLNO-100216-1

Name

MO1-dync2li1

Previous Names

dync2-li1MO1sp (1)

Target

dync2li1 (1)

Sequence

5' - GGACTGTCACTTTTACCGTATTATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dync2li1

Expressed Gene	Anatomy	Figures
ift88	retinal photoreceptor layer photoreceptor connecting cilium	Fig. 6 from Krock et al., 2009

Phenotype

Phenotype resulting from MO1-dync2li1

Phenotype	Fish	Figures
eye decreased size, abnormal	WT + MO1-dync2li1	Fig. 2, Fig. 3 from Krock et al., 2009
hindbrain swollen, abnormal	WT + MO1-dync2li1	Fig. 2 from Krock et al., 2009
intraciliary transport disrupted, abnormal	WT + MO1-dync2li1	Fig. 6 from Krock et al., 2009
olfactory epithelium axoneme swollen, abnormal	WT + MO1-dync2li1	Fig. 5 from Krock et al., 2009
olfactory epithelium non-motile cilium decreased length, abnormal	WT + MO1-dync2li1	Fig. 5 from Krock et al., 2009
photoreceptor cell intraciliary transport particle mislocalised, abnormal	WT + MO1-dync2li1	Fig. 6 from Krock et al., 2009
photoreceptor cell photoreceptor connecting cilium swollen, abnormal	WT + MO1-dync2li1	Fig. 4 from Krock et al., 2009
photoreceptor cell photoreceptor outer segment decreased length, abnormal	WT + MO1-dync2li1	Fig. 4, Fig. 6 from Krock et al., 2009
photoreceptor cell photoreceptor outer segment membrane disorganized, abnormal	WT + MO1-dync2li1	Fig. 4 from Krock et al., 2009
photoreceptor cell photoreceptor outer segment membrane vacuolated, abnormal	WT + MO1-dync2li1	Fig. 4 from Krock et al., 2009
pronephric duct motile cilium decreased amount, abnormal	WT + MO1-dync2li1	Fig. 5 from Krock et al., 2009
pronephric duct motile cilium decreased length, abnormal	WT + MO1-dync2li1	Fig. 5 from Krock et al., 2009
pronephros cystic, abnormal	WT + MO1-dync2li1	Fig. 2, Fig. 5 from Krock et al., 2009
whole organism decreased length, abnormal	WT + MO1-dync2li1	Fig. 2 from Krock et al., 2009

Phenotype of all Fish created by or utilizing MO1-dync2li1

Phenotype	Fish	Conditions	Figures
intraciliary transport disrupted, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 6 from Krock et al., 2009
olfactory epithelium axoneme swollen, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 5 from Krock et al., 2009
photoreceptor cell photoreceptor connecting cilium swollen, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 4 from Krock et al., 2009
photoreceptor cell photoreceptor outer segment decreased length, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 4, Fig. 6 from Krock et al., 2009
photoreceptor cell photoreceptor outer segment membrane vacuolated, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 4 from Krock et al., 2009
photoreceptor cell photoreceptor outer segment membrane disorganized, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 4 from Krock et al., 2009
pronephric duct motile cilium decreased length, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 5 from Krock et al., 2009
photoreceptor cell intraciliary transport particle mislocalised, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 6 from Krock et al., 2009
eye decreased size, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 2, Fig. 3 from Krock et al., 2009
hindbrain swollen, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 2 from Krock et al., 2009
olfactory epithelium non-motile cilium decreased length, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 5 from Krock et al., 2009
pronephric duct motile cilium decreased amount, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 5 from Krock et al., 2009
whole organism decreased length, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 2 from Krock et al., 2009
pronephros cystic, abnormal	WT + MO1-dync2li1	standard conditions	Fig. 2, Fig. 5 from Krock et al., 2009

Citations