Morpholino
MO1-ric8b
- ID
- ZDB-MRPHLNO-100127-1
- Name
- MO1-ric8b
- Previous Names
-
- symbl MO (1)
- Target
- Sequence
-
5' - ACTGTCACTCTCACCTTATCACAGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ric8b
No data available
Phenotype
Phenotype resulting from MO1-ric8b
| Phenotype | Fish | Figures |
|---|---|---|
| integument melanocyte morphology, abnormal | WT + MO1-ric8b |
Fig. 6 |
Phenotype of all Fish created by or utilizing MO1-ric8b
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| integument melanocyte morphology, abnormal | WT + MO1-ric8b | standard conditions |
Fig. 6 |
Citations