header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-091230-1
Morpholino Name: MO5-mef2ca
Target: mef2ca (1)
Sequence:
5' - CCTTCCTCTTCCAAAAGTACAGTCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-mef2ca No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-mef2ca No data available
PHENOTYPE
Phenotype resulting from MO5-mef2ca
Phenotype of all Fish created by or utilizing MO5-mef2ca
OTHER MO5-mef2ca MORPHOLINO PAGESNo links to external sites
CITATIONS (2)