Morpholino
MO2-musk
- ID
- ZDB-MRPHLNO-091209-1
- Name
- MO2-musk
- Previous Names
-
- unplugged FL MO (1)
- Target
- Sequence
-
5' - GTAGAGGATTACCGTATTGCCGTTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
targeted to the longest of the three musk transcripts
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-musk
Expressed Gene | Anatomy | Figures |
---|---|---|
chrna1 |
Fig. 6
from Müller et al., 2010 Fig. 1 ![]() |
Phenotype
Phenotype resulting from MO2-musk
Phenotype of all Fish created by or utilizing MO2-musk
Citations
- McMacken, G., Cox, D., Roos, A., Müller, J., Whittaker, R., Lochmüller, H. (2018) The Beta-Adrenergic Agonist Salbutamol Modulates Neuromuscular Junction Formation in Zebrafish Models of Human Myasthenic Syndromes. Human molecular genetics. 27(9):1556-1564
- Müller, J.S., Jepson, C.D., Laval, S.H., Bushby, K., Straub, V., and Lochmüller, H. (2010) Dok-7 promotes slow muscle integrity as well as neuromuscular junction formation in a zebrafish model of congenital myasthenic syndromes. Human molecular genetics. 19(9):1726-1740
- Jing, L., Lefebvre, J.L., Gordon, L.R., and Granato, M. (2009) Wnt signals organize synaptic prepattern and axon guidance through the zebrafish unplugged/MuSK receptor. Neuron. 61(5):721-733
- Zhang, J., Lefebvre, J.L., Zhao, S., and Granato, M. (2004) Zebrafish unplugged reveals a role for muscle-specific kinase homologs in axonal pathway choice. Nature Neuroscience. 7(12):1303-1309
1 - 4 of 4
Show