header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090925-1
Morpholino Name: MO1-ccng1
Target: ccng1 (1)
Previous Name: MoCcng1Tln (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGTTTCGGTCACCTGGTCAATCATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Sequence in ZDB-PUB-090123-17 contains a typo. The corrected sequence is shown here.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ccng1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ccng1 No data available
PHENOTYPE
Phenotype resulting from MO1-ccng1
No data available

Phenotype of all Fish created by or utilizing MO1-ccng1
No data available
OTHER MO1-ccng1 MORPHOLINO PAGES No links to external sites
CITATIONS (1)