Morpholino
MO1-lnx2b
- ID
- ZDB-MRPHLNO-090918-1
- Name
- MO1-lnx2b
- Previous Names
-
- lnx-l 5' UTR MO (1)
- Target
- Sequence
-
5' - CCTACGCCTCTTTCACAGCTCACAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lnx2b
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| chrd |
Fig. 1
from Ro et al., 2009 |
|
| dharma |
Fig. 5
from Ro et al., 2009 |
|
| gsc |
Fig. 1,
Fig. 4,
Fig. 5
from Ro et al., 2009 |
|
| vent |
Fig. 1
from Ro et al., 2009 |
|
| vox |
Fig. 1
from Ro et al., 2009 |
1 - 5 of 5
Phenotype
Phenotype resulting from MO1-lnx2b
| Phenotype | Fish | Figures |
|---|---|---|
| whole organism wholly dorsalized, abnormal | WT + MO1-lnx2b |
Fig. 1,
Fig. 4,
Fig. 5
from Ro et al., 2009 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-lnx2b
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| whole organism wholly dorsalized, abnormal | WT + MO1-lnx2b | standard conditions |
Fig. 1,
Fig. 4,
Fig. 5
from Ro et al., 2009 |
1 - 1 of 1
Citations
- Ro, H., and Dawid, I.B. (2010) Lnx-2b restricts gsc expression to the dorsal mesoderm by limiting Nodal and Bozozok activity. Biochemical and Biophysical Research Communications. 402(4):626-630
- Ro, H., and Dawid, I.B. (2009) Organizer restriction through modulation of Bozozok stability by the E3 ubiquitin ligase Lnx-like. Nature cell biology. 11(9):1121-1127
1 - 2 of 2
Show