Morpholino

MO1-srrm4

ID
ZDB-MRPHLNO-090917-2
Name
MO1-srrm4
Previous Names
  • MO1-si:dkey-1k23.1
  • znsr100 MOspl (1)
Target
Sequence
5' - TCAATCACTACCTATGTCGCTTCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-srrm4
No data available
Phenotype
Phenotype resulting from MO1-srrm4
Phenotype of all Fish created by or utilizing MO1-srrm4
Phenotype Fish Conditions Figures
ventricular system increased volume, abnormal AB/TL + MO1-srrm4 + MO4-tp53 standard conditions Fig. 6 with image from Calarco et al., 2009
whole organism curved ventral, abnormal AB/TL + MO1-srrm4 + MO4-tp53 standard conditions Fig. 6 with image from Calarco et al., 2009
axonogenesis disrupted, abnormal zf154Tg + MO1-srrm4 + MO4-tp53 standard conditions Fig. 6 with image from Calarco et al., 2009
trigeminal ganglion axon decreased length, abnormal zf154Tg + MO1-srrm4 + MO4-tp53 standard conditions Fig. 6 with image from Calarco et al., 2009
facial nerve motor nucleus motor neuron migration occurrence, ameliorated restsbu29/sbu29 ; rw0Tg + MO1-srrm4 control Fig. 6 with image from Love et al., 2015
facial nerve motor nucleus motor neuron displaced to rhombomere 4, ameliorated restsbu29/sbu29 ; rw0Tg + MO1-srrm4 control Fig. 6 with image from Love et al., 2015
facial nerve motor nucleus motor neuron displaced to rhombomere 5, ameliorated restsbu29/sbu29 ; rw0Tg + MO1-srrm4 control Fig. 6 with image from Love et al., 2015
facial nerve motor nucleus motor neuron volume, ameliorated restsbu29/sbu29; ch100Tg + MO1-srrm4 control Fig. 6 with image from Love et al., 2015
facial nerve motor nucleus neuron projection length, ameliorated restsbu29/sbu29; ch100Tg + MO1-srrm4 control Fig. 6 with image from Love et al., 2015
facial nerve motor nucleus neuron projection amount, ameliorated restsbu29/sbu29; ch100Tg + MO1-srrm4 control Fig. 6 with image from Love et al., 2015
facial nerve motor nucleus motor neuron shape, ameliorated restsbu29/sbu29; ch100Tg + MO1-srrm4 control Fig. 6 with image from Love et al., 2015
Citations