Morpholino

MO1-ttll3

ID

ZDB-MRPHLNO-090730-3

Name

MO1-ttll3

Previous Names

Target

Sequence

5' - GTGTTGGTGCATGTTTGAGTTAACC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

targets the translation initiation site of ttll3 mRNA

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ttll3

No data available

Phenotype

Phenotype resulting from MO1-ttll3

Phenotype	Fish	Figures
determination of left/right symmetry disrupted, abnormal	WT + MO1-ttll3	Fig. 7 from Wloga et al., 2009
epiphysis bilateral symmetry, abnormal	WT + MO1-ttll3	Fig. 7 from Wloga et al., 2009
fourth ventricle increased size, abnormal	WT + MO1-ttll3	Fig. 5 from Wloga et al., 2009
heart bilateral symmetry, abnormal	WT + MO1-ttll3	Fig. 7 from Wloga et al., 2009
heart mislocalised, abnormal	WT + MO1-ttll3	Fig. 7 from Wloga et al., 2009
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-ttll3	Fig. 7 from Wloga et al., 2009
olfactory placode cilium decreased amount, abnormal	WT + MO1-ttll3	Fig. 5 from Wloga et al., 2009
olfactory placode cilium decreased length, abnormal	WT + MO1-ttll3	Fig. 5 from Wloga et al., 2009
olfactory placode cilium malformed, abnormal	WT + MO1-ttll3	Fig. 5 from Wloga et al., 2009
post-vent region curved, abnormal	WT + MO1-ttll3	Fig. 5 from Wloga et al., 2009

Phenotype of all Fish created by or utilizing MO1-ttll3

Phenotype	Fish	Conditions	Figures
fourth ventricle increased size, abnormal	WT + MO1-ttll3	standard conditions	Fig. 5 from Wloga et al., 2009
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-ttll3	standard conditions	Fig. 7 from Wloga et al., 2009
olfactory placode cilium decreased length, abnormal	WT + MO1-ttll3	standard conditions	Fig. 5 from Wloga et al., 2009
olfactory placode cilium malformed, abnormal	WT + MO1-ttll3	standard conditions	Fig. 5 from Wloga et al., 2009
olfactory placode cilium decreased amount, abnormal	WT + MO1-ttll3	standard conditions	Fig. 5 from Wloga et al., 2009
determination of left/right symmetry disrupted, abnormal	WT + MO1-ttll3	standard conditions	Fig. 7 from Wloga et al., 2009
epiphysis bilateral symmetry, abnormal	WT + MO1-ttll3	standard conditions	Fig. 7 from Wloga et al., 2009
post-vent region curved, abnormal	WT + MO1-ttll3	standard conditions	Fig. 5 from Wloga et al., 2009
heart bilateral symmetry, abnormal	WT + MO1-ttll3	standard conditions	Fig. 7 from Wloga et al., 2009
heart mislocalised, abnormal	WT + MO1-ttll3	standard conditions	Fig. 7 from Wloga et al., 2009

Citations