Morpholino
MO1-apobec2a
- ID
- ZDB-MRPHLNO-090618-1
- Name
- MO1-apobec2a
- Previous Names
- None
- Target
- Sequence
-
5' - GCTGCTGCCCTTTCTATCGGCCATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-apobec2a
No data available
Phenotype
Phenotype resulting from MO1-apobec2a
Phenotype of all Fish created by or utilizing MO1-apobec2a
Citations
- Powell, C., Cornblath, E., Goldman, D. (2014) Zinc-binding Domain-dependent, Deaminase-independent Actions of Apolipoprotein B mRNA-editing Enzyme, Catalytic Polypeptide 2 (Apobec2), Mediate Its Effect on Zebrafish Retina Regeneration. The Journal of biological chemistry. 289(42):28924-41
- Powell, C., Grant, A.R., Cornblath, E., and Goldman, D. (2013) Analysis of DNA methylation reveals a partial reprogramming of the Muller glia genome during retina regeneration. Proceedings of the National Academy of Sciences of the United States of America. 110(49):19814-19819
- Powell, C., Elsaeidi, F., and Goldman, D. (2012) Injury-Dependent Muller Glia and Ganglion Cell Reprogramming during Tissue Regeneration Requires Apobec2a and Apobec2b. The Journal of neuroscience : the official journal of the Society for Neuroscience. 32(3):1096-1109
- Rai, K., Sarkar, S., Broadbent, T.J., Voas, M., Grossmann, K.F., Nadauld, L.D., Dehghanizadeh, S., Hagos, F.T., Li, Y., Toth, R.K., Chidester, S., Bahr, T.M., Johnson, W.E., Sklow, B., Burt, R., Cairns, B.R., and Jones, D.A. (2010) DNA demethylase activity maintains intestinal cells in an undifferentiated state following loss of APC. Cell. 142(6):930-942
- Rai, K., Huggins, I.J., James, S.R., Karpf, A.R., Jones, D.A., and Cairns, B.R. (2008) DNA demethylation in zebrafish involves the coupling of a deaminase, a glycosylase, and gadd45. Cell. 135(7):1201-1212
1 - 5 of 5
Show