Morpholino
MO3-daam1a
- ID
- ZDB-MRPHLNO-090609-16
- Name
- MO3-daam1a
- Previous Names
-
- MO3-daam1
- Target
- Sequence
-
5' - TCTTGACTTGCCCACCTGAAAGCGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-daam1a
No data available
Phenotype
Phenotype resulting from MO3-daam1a
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO3-daam1a
1 - 5 of 6 Show all
Citations
- Miller, R.K., Gomez de la Torre Canny, S., Jang, C.W., Cho, K., Ji, H., Wagner, D.S., Jones, E.A., Habas, R., and McCrea, P.D. (2011) Pronephric Tubulogenesis Requires Daam1-Mediated Planar Cell Polarity Signaling. Journal of the American Society of Nephrology : JASN. 22(9):1654-64
- Skouloudaki, K., Puetz, M., Simons, M., Courbard, J.R., Boehlke, C., Hartleben, B., Engel, C., Moeller, M.J., Englert, C., Bollig, F., Schäfer, T., Ramachandran, H., Mlodzik, M., Huber, T.B., Kuehn, E.W., Kim, E., Kramer-Zucker, A., and Walz, G. (2009) Scribble participates in Hippo signaling and is required for normal zebrafish pronephros development. Proceedings of the National Academy of Sciences of the United States of America. 106(21):8579-8584
1 - 2 of 2
Show