Morpholino

MO1-plekhg5a

ID
ZDB-MRPHLNO-090421-1
Name
MO1-plekhg5a
Previous Names
  • MO1-plekhg5
Target
Sequence
5' - AGCTGTTTCTGTGTGGCCTGCTGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-plekhg5a
Expressed Gene Anatomy Figures
etsrp Fig. 3 from Garnaas et al., 2008
fli1 Fig. 3 from Garnaas et al., 2008
flt4 text only from Garnaas et al., 2008
hey2 text only from Garnaas et al., 2008
Phenotype
Phenotype resulting from MO1-plekhg5a
Phenotype Fish Figures
angiogenesis disrupted, abnormal zf528Tg + MO1-plekhg5a Fig. 5 from Garnaas et al., 2008
blood vessel morphogenesis disrupted, abnormal zf528Tg + MO1-plekhg5a Fig. 2,  Fig. 3,  Fig. 5,  text only from Garnaas et al., 2008
endothelial tip cell circular, abnormal zf528Tg + MO1-plekhg5a Fig. 5 from Garnaas et al., 2008
endothelial tip cell filopodium absent, abnormal zf528Tg + MO1-plekhg5a Fig. 5 from Garnaas et al., 2008
intersegmental vessel truncated, abnormal zf528Tg + MO1-plekhg5a Fig. 2,  Fig. 3,  Fig. 5,  text only from Garnaas et al., 2008
post-vent region decreased length, abnormal WT + MO1-plekhg5a Fig. 5 with image from Goh et al., 2010
post-vent region kinked, abnormal WT + MO1-plekhg5a Fig. 5 with image from Goh et al., 2010
whole organism decreased length, abnormal WT + MO1-plekhg5a Fig. 5 with image,  Fig. S2 with image from Goh et al., 2010
whole organism viability, abnormal WT + MO1-plekhg5a Fig. 5 with image,  Fig. S2 with image from Goh et al., 2010
Phenotype of all Fish created by or utilizing MO1-plekhg5a
Phenotype Fish Conditions Figures
post-vent region decreased length, abnormal WT + MO1-plekhg5a standard conditions Fig. 5 with image from Goh et al., 2010
whole organism viability, abnormal WT + MO1-plekhg5a standard conditions Fig. 5 with image,  Fig. S2 with image from Goh et al., 2010
whole organism decreased length, abnormal WT + MO1-plekhg5a standard conditions Fig. 5 with image,  Fig. S2 with image from Goh et al., 2010
intersegmental vessel truncated, abnormal WT + MO1-plekhg5a standard conditions Fig. 3 from Garnaas et al., 2008
post-vent region kinked, abnormal WT + MO1-plekhg5a standard conditions Fig. 5 with image from Goh et al., 2010
blood vessel morphogenesis disrupted, abnormal WT + MO1-plekhg5a standard conditions Fig. 3 from Garnaas et al., 2008
whole organism viability, abnormal WT + MO1-plekhg5a + MO4-tp53 standard conditions Fig. S2 with image from Goh et al., 2010
whole organism decreased length, abnormal WT + MO1-plekhg5a + MO4-tp53 standard conditions Fig. S2 with image from Goh et al., 2010
intersegmental vessel truncated, abnormal y1Tg + MO1-plekhg5a standard conditions Fig. 2 from Garnaas et al., 2008
blood vessel morphogenesis disrupted, abnormal y1Tg + MO1-plekhg5a standard conditions Fig. 2 from Garnaas et al., 2008
angiogenesis disrupted, abnormal zf528Tg + MO1-plekhg5a standard conditions Fig. 5 from Garnaas et al., 2008
blood vessel morphogenesis disrupted, abnormal zf528Tg + MO1-plekhg5a standard conditions Fig. 5,  text only from Garnaas et al., 2008
endothelial tip cell circular, abnormal zf528Tg + MO1-plekhg5a standard conditions Fig. 5 from Garnaas et al., 2008
intersegmental vessel truncated, abnormal zf528Tg + MO1-plekhg5a standard conditions Fig. 5,  text only from Garnaas et al., 2008
endothelial tip cell filopodium absent, abnormal zf528Tg + MO1-plekhg5a standard conditions Fig. 5 from Garnaas et al., 2008
endothelial tip cell circular, abnormal zf528Tg + MO1-plekhg5a + MO2-amot standard conditions Fig. 5 from Garnaas et al., 2008
intersegmental vessel truncated, abnormal zf528Tg + MO1-plekhg5a + MO2-amot standard conditions Fig. 5 from Garnaas et al., 2008
blood vessel morphogenesis disrupted, abnormal zf528Tg + MO1-plekhg5a + MO2-amot standard conditions Fig. 5 from Garnaas et al., 2008
endothelial tip cell filopodium absent, abnormal zf528Tg + MO1-plekhg5a + MO2-amot standard conditions Fig. 5 from Garnaas et al., 2008
angiogenesis disrupted, abnormal zf528Tg + MO1-plekhg5a + MO2-amot standard conditions Fig. 5 from Garnaas et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.