Morpholino
MO2-chst11
- ID
- ZDB-MRPHLNO-090417-3
- Name
- MO2-chst11
- Previous Names
- None
- Target
- Sequence
-
5' - CTGCCGAGCCGAGCCCCGTTCAGCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-chst11
No data available
Phenotype
Phenotype resulting from MO2-chst11
Phenotype | Fish | Figures |
---|---|---|
post-vent region curved, abnormal | WT + MO2-chst11 |
Fig. 5
from Mizumoto et al., 2009 |
trunk bent, abnormal | WT + MO2-chst11 |
Fig. 5
from Mizumoto et al., 2009 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO2-chst11
1 - 5 of 6 Show all
Citations
- Sahu, S., Li, R., Loers, G., Schachner, M. (2018) Knockdown of chondroitin-4-sulfotransferase-1, but not of dermatan-4-sulfotransferase-1, accelerates regeneration of zebrafish after spinal cord injury. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 33(2):2252-2262
- Mizumoto, S., Mikami, T., Yasunaga, D., Kobayashi, N., Yamauchi, H., Miyake, A., Itoh, N., Kitagawa, H., and Sugahara, K. (2009) Chondroitin 4-O-sulfotransferase-1 is required for somitic muscle development and motor axon guidance in zebrafish. The Biochemical journal. 419(2):387-399
1 - 2 of 2
Show