Morpholino
MO1-cald1b
- ID
- ZDB-MRPHLNO-090413-1
- Name
- MO1-cald1b
- Previous Names
- None
- Target
- Sequence
-
5' - AGTAAAGTCTCTTATTCTTCAACGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking morpholino
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cald1b
Expressed Gene | Anatomy | Figures |
---|---|---|
cald1b |
|
Fig. 1
from Zheng et al., 2009 |
flt1 |
Fig. 2
from Zheng et al., 2009 |
|
kdrl |
Fig. 2
from Zheng et al., 2009 |
|
slc2a1a |
|
Fig. 4,
Fig. 5
from Zheng et al., 2009 |
1 - 4 of 4
Phenotype
Phenotype resulting from MO1-cald1b
1 - 5 of 41 Show all
Phenotype of all Fish created by or utilizing MO1-cald1b
1 - 5 of 41 Show all
Citations
- Zheng, P.P., Severijnen, L.A., Willemsen, R., and Kros, J.M. (2010) Different Patterns of Circulatory Shunting in Zebrafish Caldesmon Morphants: A Digital Motion Analysis. Heart, lung & circulation. 19(4):251-252
- Zheng, P.P., Severijnen, L.A., van der Weiden, M., Willemsen, R., and Kros, J.M. (2009) A crucial role of caldesmon in vascular development in vivo. Cardiovascular research. 81(2):362-369
- Zheng, P.P., Severijnen, L.A., Willemsen, R., and Kros, J.M. (2009) Circulation status of subintestinal vessels is a sensitive parameter for monitoring suboptimal systemic circulation in experimental zebrafish embryos. Cell cycle (Georgetown, Tex.). 8(22):3782-3783
- Zheng, P.P., Severijnen, L.A., Willemsen, R., and Kros, J.M. (2009) Caldesmon is essential for cardiac morphogenesis and function: In vivo study using a zebrafish model. Biochemical and Biophysical Research Communications. 378(1):37-40
- Zheng, P.P., Severijnen, L.A., Willemsen, R., and Kros, J.M. (2009) Images in Cardiovascular Medicine. Functional cardiac phenotypes in zebrafish caldesmon morphants: a digital motion analysis. Circulation. 120(17):e145-e146
1 - 5 of 5
Show