Morpholino
MO1-ofd1
- ID
- ZDB-MRPHLNO-090312-2
- Name
- MO1-ofd1
- Previous Names
-
- ofd1 SPL6 MO (1)
- Target
- Sequence
-
5' - ATCTTCTCTACTGCAACACACATAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ofd1
No data available
Phenotype
Phenotype resulting from MO1-ofd1
1 - 5 of 23 Show all
Phenotype of all Fish created by or utilizing MO1-ofd1
1 - 5 of 29 Show all
Citations
- Liu, Y.P., Tsai, I.C., Morleo, M., Oh, E.C., Leitch, C.C., Massa, F., Lee, B.H., Parker, D.S., Finley, D., Zaghloul, N.A., Franco, B., Katsanis, N. (2014) Ciliopathy proteins regulate paracrine signaling by modulating proteasomal degradation of mediators. J. Clin. Invest.. 124(5):2059-70
- Lopes, C.A., Prosser, S.L., Romio, L., Hirst, R.A., O'Callaghan, C., Woolf, A.S., and Fry, A.M. (2011) Centriolar satellites are assembly points for proteins implicated in human ciliopathies, including oral-facial-digital syndrome 1. Journal of Cell Science. 124(Pt 4):600-612
- Ferrante, M.I., Romio, L., Castro, S., Collins, J.E., Goulding, D.A., Stemple, D.L., Woolf, A.S., and Wilson, S.W. (2009) Convergent Extension Movements and Ciliary Function are Mediated by ofd1, A Zebrafish Orthologue of the Human Oral-Facial-Digital Type 1 Syndrome Gene. Human molecular genetics. 18(2):289-303
1 - 3 of 3
Show