ZFIN ID: ZDB-MRPHLNO-090121-3
Morpholino Name: MO3-pax2a
Target: pax2a (1)
Previous Name: pax2a E2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TATGTGCTTTTTCTTACCTTCCGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets splice donor site of exon 2.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-pax2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-pax2a
Expressed Gene Anatomy Figures
cdh17 Fig. 5 from Naylor et al., 2013
hhex Fig. 8 with image from Porreca et al., 2012
hnf1ba Fig. 5 from Naylor et al., 2013
hnf1bb Fig. 5 from Naylor et al., 2013
slc12a1 Fig. 5 from Naylor et al., 2013
slc12a3 Fig. 5 from Naylor et al., 2013
slc20a1a Fig. 5 from Naylor et al., 2013
PHENOTYPE
Phenotype resulting from MO3-pax2a
No data available

Phenotype of all Fish created by or utilizing MO3-pax2a
Phenotype Fish Conditions Figures
regulation of pronephric nephron tubule development decreased process quality, abnormal pax8nia03Gt/nia03Gt + MO3-pax2a standard conditions Fig. 5 from Naylor et al., 2013
pronephros poorly differentiated, abnormal pax8nia03Gt/nia03Gt + MO3-pax2a standard conditions Fig. 5 from Naylor et al., 2013
OTHER MO3-pax2a MORPHOLINO PAGESNo links to external sites
CITATIONS (3)