ZFIN ID: ZDB-MRPHLNO-090115-2
Morpholino Name: MO2-diaph2
Target: diaph2 (1)
Previous Name: sMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTTGTGGTGCACTTACAGATTTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking morpholino targeting the splicing donor of the fourth intron to delete the core Rho-binding domain.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-diaph2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-diaph2
Expressed Gene Anatomy Figures
ctslb Fig. S2 with image from Lai et al., 2008
gsc Fig. 5 with imageFig. S5 with image from Lai et al., 2008
myod1 Fig. S2 with image from Lai et al., 2008
tbxta Fig. 5 with imageFig. S5 with image from Lai et al., 2008
PHENOTYPE
Phenotype resulting from MO2-diaph2
Phenotype of all Fish created by or utilizing MO2-diaph2
Phenotype Fish Conditions Figures
somite increased width, abnormal WT + MO2-diaph2 standard conditions Fig. S2 with image from Lai et al., 2008
tail bud aplastic, abnormal WT + MO2-diaph2 standard conditions Fig. 5 with image from Lai et al., 2008
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO2-diaph2 standard conditions Fig. S4 with imagetext only from Lai et al., 2008
epiboly involved in gastrulation with mouth forming second arrested, abnormal WT + MO2-diaph2 standard conditions Fig. 5 with image from Lai et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-diaph2 standard conditions Fig. 5 with imageFig. S2 with imageFig. S5 with imagetext only from Lai et al., 2008
hypoblast cell projection decreased amount, abnormal WT + MO2-diaph2 standard conditions Fig. 7 with image from Lai et al., 2008
margin filamentous actin decreased amount, abnormal WT + MO2-diaph2 standard conditions Fig. 8 with image from Lai et al., 2008
yolk syncytial layer filamentous actin absent, abnormal WT + MO2-diaph2 standard conditions Fig. S4 with image from Lai et al., 2008
bleb assembly disrupted, abnormal WT + MO2-diaph2 standard conditions Fig. 6 with image from Lai et al., 2008
notochord increased width, abnormal WT + MO2-diaph2 standard conditions Fig. 5 with imageFig. S5 with image from Lai et al., 2008
prechordal plate cell projection decreased amount, abnormal WT + MO2-diaph2 standard conditions Fig. 7 with image from Lai et al., 2008
axis decreased length, abnormal WT + MO2-diaph2 standard conditions Fig. 5 with imageFig. S2 with imageFig. S5 with image from Lai et al., 2008
margin bleb absent, abnormal WT + MO2-diaph2 standard conditions Fig. 6 with image from Lai et al., 2008
cell migration involved in gastrulation decreased rate, abnormal WT + MO2-diaph2 standard conditions Fig. 6 with image from Lai et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-pfn1 + MO2-diaph2 standard conditions Fig. S5 with imagetext only from Lai et al., 2008
notochord increased width, abnormal WT + MO1-pfn1 + MO2-diaph2 standard conditions Fig. S5 with image from Lai et al., 2008
axis decreased length, abnormal WT + MO1-pfn1 + MO2-diaph2 standard conditions Fig. S5 with image from Lai et al., 2008
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO1-pfn1 + MO2-diaph2 standard conditions text only from Lai et al., 2008
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO1-pfn2 + MO2-diaph2 standard conditions text only from Lai et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-pfn2 + MO2-diaph2 standard conditions text only from Lai et al., 2008
Genome Resources:
CITATIONS (1)