Morpholino
MO1-dock4a
- ID
- ZDB-MRPHLNO-090112-1
- Name
- MO1-dock4a
- Previous Names
-
- zDOCK4 (1)
- Target
- Sequence
-
5' - GTACCATCCTTCACATTTTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dock4a
Expressed Gene | Anatomy | Figures |
---|---|---|
gata1a |
Fig. S4 ![]() |
Phenotype
Phenotype resulting from MO1-dock4a
Phenotype of all Fish created by or utilizing MO1-dock4a
Citations
- Sundaravel, S., Duggan, R., Bhagat, T., Ebenezer, D.L., Liu, H., Yu, Y., Bartenstein, M., Unnikrishnan, M., Karmakar, S., Liu, T.C., Torregroza, I., Quenon, T., Anastasi, J., McGraw, K.L., Pellagatti, A., Boultwood, J., Yajnik, V., Artz, A., Le Beau, M.M., Steidl, U., List, A.F., Evans, T., Verma, A., Wickrema, A. (2015) Reduced DOCK4 expression leads to erythroid dysplasia in myelodysplastic syndromes. Proceedings of the National Academy of Sciences of the United States of America. 112:E6359-68
- Upadhyay, G., Goessling, W., North, T.E., Xavier, R., Zon, L.I., and Yajnik, V. (2008) Molecular association between beta-catenin degradation complex and Rac guanine exchange factor DOCK4 is essential for Wnt/beta-catenin signaling. Oncogene. 27(44):5845-5855
1 - 2 of 2
Show