Community Action Needed: Please respond to the NIH RFI
Morpholino

MO2-fli1

ID
ZDB-MRPHLNO-081231-1
Name
MO2-fli1
Previous Names
  • Fli1MO (1)
  • MO2-fli1a
  • fli1 utrMO (1)
Target
Sequence
5' - TTTCCGCAATTTTCAGTGGAGCCCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The morpholino has a single-nt mismatch at position 4 (C vs G in the reference genome and transcript population).
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fli1
Expressed Gene Anatomy Figures
cdh5 Fig. S4 from Liu et al., 2008
Phenotype
Phenotype resulting from MO2-fli1
Phenotype of all Fish created by or utilizing MO2-fli1
Citations