header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-081229-6
Morpholino Name: MO2-myl7
Target: myl7 (1)
Previous Name: MO-cmlc2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTCAAGTGTACCTAGTTGTGCATAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-myl7 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-myl7
Expressed Gene Anatomy Figures
cmlc1 Fig. 3 from Chen et al., 2008
myh7 Fig. 3 from Chen et al., 2008
myl7 Fig. 3 from Chen et al., 2008
ttn.2 Fig. 3 from Chen et al., 2008
PHENOTYPE
Phenotype resulting from MO2-myl7
Phenotype of all Fish created by or utilizing MO2-myl7
Genome Resources:
CITATIONS (2)