Morpholino

MO2-anos1a

ID
ZDB-MRPHLNO-081216-1
Name
MO2-anos1a
Previous Names
None
Target
Sequence
5' - GGTGAGCCCGTCTCGCATCTTGAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker, note possible typo in published sequence at position 13 - the following version is a better match to known sequences 5'- GGTGAGCCCGTCGCGCATCTTGAAG -3'
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-anos1a
No data available
Phenotype
Phenotype resulting from MO2-anos1a
Phenotype Fish Figures
anterior lateral line neuromast decreased amount, abnormal WT + MO2-anos1a text only from Yanicostas et al., 2008
axon guidance disrupted, abnormal AB + MO2-anos1a Fig. 2 with imageFig. 4 with image from Yanicostas et al., 2009
fasciculation of sensory neuron axon disrupted, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
glomerular layer aplastic, abnormal AB + MO2-anos1a Fig. 4 with image from Yanicostas et al., 2009
innervation disrupted, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
neuromast hair cell decreased amount, abnormal WT + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2008
neuromast primordium migration delayed, abnormal kca66Tg + MO2-anos1a Fig. 3 with imageFig. 5 with imageFig. S5 with image from Yanicostas et al., 2008
olfactory bulb disorganized, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
olfactory bulb dopaminergic neuron decreased amount, abnormal AB + MO2-anos1a Fig. 6 with image from Yanicostas et al., 2009
olfactory bulb GABAergic neuron decreased amount, abnormal AB + MO2-anos1a Fig. 5 with image from Yanicostas et al., 2009
olfactory bulb development disrupted, abnormal AB + MO2-anos1a Fig. 2 with imageFig. 4 with image from Yanicostas et al., 2009
olfactory epithelium disorganized, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
olfactory epithelium split, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
olfactory placode disorganized, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
olfactory receptor cell spatial pattern, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
olfactory receptor cell axon decreased length, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
olfactory receptor cell axon disorganized, abnormal jt0012Tg + MO2-anos1a Fig. 3 with imageFig. 4 with image from Yanicostas et al., 2009
posterior lateral line nerve decreased length, abnormal kca66Tg + MO2-anos1a Fig. S4 with imageFig. S5 with image from Yanicostas et al., 2008
posterior lateral line nerve development disrupted, abnormal kca66Tg + MO2-anos1a Fig. S4 with imageFig. S5 with image from Yanicostas et al., 2008
posterior lateral line neuromast decreased amount, abnormal WT + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2008
posterior lateral line neuromast malformed, abnormal WT + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2008
posterior lateral line primordium circular, abnormal zf106Tg + MO2-anos1a Fig. 4 with image from Yanicostas et al., 2008
posterior lateral line primordium crescent-shaped, abnormal zf106Tg + MO2-anos1a Fig. 4 with image from Yanicostas et al., 2008
Phenotype of all Fish created by or utilizing MO2-anos1a
Phenotype Fish Conditions Figures
olfactory bulb development disrupted, abnormal AB + MO2-anos1a standard conditions Fig. 4 with image from Yanicostas et al., 2009
axon guidance disrupted, abnormal AB + MO2-anos1a standard conditions Fig. 4 with image from Yanicostas et al., 2009
olfactory receptor cell axon disorganized, abnormal AB + MO2-anos1a standard conditions Fig. 4 with image from Yanicostas et al., 2009
olfactory bulb dopaminergic neuron decreased amount, abnormal AB + MO2-anos1a standard conditions Fig. 6 with image from Yanicostas et al., 2009
olfactory bulb GABAergic neuron decreased amount, abnormal AB + MO2-anos1a standard conditions Fig. 5 with image from Yanicostas et al., 2009
glomerular layer aplastic, abnormal AB + MO2-anos1a standard conditions Fig. 4 with image from Yanicostas et al., 2009
neuromast primordium migration delayed, abnormal WT + MO2-anos1a standard conditions Fig. 3 with image from Yanicostas et al., 2008
posterior lateral line neuromast decreased amount, abnormal WT + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2008
posterior lateral line neuromast malformed, abnormal WT + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2008
anterior lateral line neuromast decreased amount, abnormal WT + MO2-anos1a standard conditions text only from Yanicostas et al., 2008
neuromast hair cell decreased amount, abnormal WT + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2008
axon guidance disrupted, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory receptor cell axon disorganized, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 3 with image from Yanicostas et al., 2009
olfactory placode disorganized, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory epithelium split, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory bulb development disrupted, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory bulb disorganized, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory epithelium disorganized, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
innervation disrupted, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
fasciculation of sensory neuron axon disrupted, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory receptor cell spatial pattern, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory receptor cell axon decreased length, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
posterior lateral line nerve decreased length, abnormal kca66Tg + MO2-anos1a standard conditions Fig. S4 with image from Yanicostas et al., 2008
neuromast primordium migration delayed, abnormal kca66Tg + MO2-anos1a standard conditions Fig. 5 with image from Yanicostas et al., 2008
posterior lateral line nerve development disrupted, abnormal kca66Tg + MO2-anos1a standard conditions Fig. S4 with image from Yanicostas et al., 2008
posterior lateral line nerve development disrupted, abnormal zf106Tg + MO2-anos1a standard conditions Fig. S5 with image from Yanicostas et al., 2008
posterior lateral line primordium crescent-shaped, abnormal zf106Tg + MO2-anos1a standard conditions Fig. 4 with image from Yanicostas et al., 2008
neuromast primordium migration delayed, abnormal zf106Tg + MO2-anos1a standard conditions Fig. 5 with imageFig. S5 with image from Yanicostas et al., 2008
posterior lateral line primordium circular, abnormal zf106Tg + MO2-anos1a standard conditions Fig. 4 with image from Yanicostas et al., 2008
posterior lateral line nerve decreased length, abnormal zf106Tg + MO2-anos1a standard conditions Fig. S5 with image from Yanicostas et al., 2008
neuromast primordium migration delayed, abnormal zf106Tg + MO2-anos1a + MO2-cxcl12a standard conditions Fig. 7 with image from Yanicostas et al., 2008
Citations