ZFIN ID: ZDB-MRPHLNO-081212-2
Morpholino Name: MO2-lpp
Target: lpp (1)
Previous Name: LPP-MO/3e3i (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCTATCAATCTTACCCTCGTGTGTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-lpp No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-lpp
Expressed Gene Anatomy Figures
bmp4 Fig. 3 with image from Vervenne et al., 2008
chrd Fig. 3 with image from Vervenne et al., 2008
ctslb Fig. 3 with image from Vervenne et al., 2008
dlx3b Fig. 3 with image from Vervenne et al., 2008
gsc Fig. 3 with image from Vervenne et al., 2008
lpp Fig. 2 with image from Vervenne et al., 2008
myod1 Fig. 3 with image from Vervenne et al., 2008
pcdh8 Fig. 3 with image from Vervenne et al., 2008
tbxta Fig. 3 with image from Vervenne et al., 2008
PHENOTYPE
Phenotype resulting from MO2-lpp
Phenotype of all Fish created by or utilizing MO2-lpp
Genome Resources:
CITATIONS (1)