Morpholino

MO1-wdr36

ID

ZDB-MRPHLNO-081120-3

Name

MO1-wdr36

Previous Names

None

Target

Sequence

5' - TCGCCAGCACAATCTTAATCTTCGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-wdr36

No data available

Phenotype

Phenotype resulting from MO1-wdr36

Phenotype	Fish	Figures
ciliary marginal zone nucleolus increased size, abnormal	WT + MO1-wdr36	Fig. 6 from Skarie et al., 2008
ciliary marginal zone nucleolus morphology, abnormal	WT + MO1-wdr36	Fig. 6 from Skarie et al., 2008
exit from mitosis delayed, abnormal	WT + MO1-wdr36	Fig. 7 from Skarie et al., 2008
eye decreased size, abnormal	WT + MO1-wdr36	Fig. 4, text only from Skarie et al., 2008
head decreased size, abnormal	WT + MO1-wdr36	Fig. 4, text only from Skarie et al., 2008
lens degenerate, abnormal	WT + MO1-wdr36	Fig. 4 from Skarie et al., 2008
regulation of mitotic cell cycle disrupted, abnormal	WT + MO1-wdr36	Fig. 7 from Skarie et al., 2008
retina cellular quality, abnormal	WT + MO1-wdr36	Fig. 7 from Skarie et al., 2008
retina development in camera-type eye disrupted, abnormal	WT + MO1-wdr36	Fig. 4 from Skarie et al., 2008

Phenotype of all Fish created by or utilizing MO1-wdr36

Phenotype	Fish	Conditions	Figures
head decreased size, abnormal	WT + MO1-wdr36	standard conditions	Fig. 4, text only from Skarie et al., 2008
retina cellular quality, abnormal	WT + MO1-wdr36	standard conditions	Fig. 7 from Skarie et al., 2008
ciliary marginal zone nucleolus increased size, abnormal	WT + MO1-wdr36	standard conditions	Fig. 6 from Skarie et al., 2008
retina development in camera-type eye disrupted, abnormal	WT + MO1-wdr36	standard conditions	Fig. 4 from Skarie et al., 2008
ciliary marginal zone nucleolus morphology, abnormal	WT + MO1-wdr36	standard conditions	Fig. 6 from Skarie et al., 2008
lens degenerate, abnormal	WT + MO1-wdr36	standard conditions	Fig. 4 from Skarie et al., 2008
regulation of mitotic cell cycle disrupted, abnormal	WT + MO1-wdr36	standard conditions	Fig. 7 from Skarie et al., 2008
exit from mitosis delayed, abnormal	WT + MO1-wdr36	standard conditions	Fig. 7 from Skarie et al., 2008
eye decreased size, abnormal	WT + MO1-wdr36	standard conditions	Fig. 4, text only from Skarie et al., 2008
eye decreased size, abnormal	tp53^zdf1/zdf1 + MO1-wdr36	standard conditions	text only from Skarie et al., 2008
head decreased size, abnormal	tp53^zdf1/zdf1 + MO1-wdr36	standard conditions	text only from Skarie et al., 2008

Citations