Morpholino

MO2-mmp14b

ID
ZDB-MRPHLNO-081029-5
Name
MO2-mmp14b
Previous Names
None
Target
Sequence
5' - GAACCCGCTCCAGATCATTTTTCGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mmp14b
No data available
Phenotype
Phenotype resulting from MO2-mmp14b
Phenotype of all Fish created by or utilizing MO2-mmp14b
Phenotype Fish Conditions Figures
brain apoptotic, abnormal WT + MO2-mmp14b standard conditions Fig. 3 from Coyle et al., 2008
axis decreased length, abnormal WT + MO2-mmp14b standard conditions Fig. 3 from Coyle et al., 2008
whole organism decreased length, abnormal WT + MO2-mmp14b standard conditions Fig. 3 from Coyle et al., 2008
notochord increased width, abnormal WT + MO2-mmp14b standard conditions Fig. 3 from Coyle et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-mmp14b standard conditions Fig. 3 from Coyle et al., 2008
cartilage development disrupted, abnormal WT + MO2-mmp14b standard conditions Fig. 2 from Coyle et al., 2008
auditory capsule morphology, abnormal WT + MO2-mmp14b standard conditions Fig. 2 from Coyle et al., 2008
extension decreased length, abnormal WT + MO2-mmp14b standard conditions Fig. 3 from Coyle et al., 2008
lateral mesoderm morphology, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 4 from Coyle et al., 2008
mesodermal cell circular, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 4 from Coyle et al., 2008
mesodermal cell migration disrupted, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 4 from Coyle et al., 2008
establishment of cell polarity disrupted, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 4 from Coyle et al., 2008
mesodermal cell disorganized, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 4 from Coyle et al., 2008
axis decreased length, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 3 from Coyle et al., 2008
mesodermal cell migration rate, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 4 from Coyle et al., 2008
whole organism decreased length, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 3 from Coyle et al., 2008
notochord increased width, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 3 from Coyle et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 3,  Fig. 4 from Coyle et al., 2008
brain apoptotic, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 3 from Coyle et al., 2008
extension decreased length, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 3 from Coyle et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 3 from Coyle et al., 2008
extension decreased length, abnormal WT + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 3 from Coyle et al., 2008
whole organism decreased length, abnormal WT + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 3 from Coyle et al., 2008
rhombomere increased width, abnormal gpc4m119/+ + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
somite increased width, abnormal gpc4m119/+ + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
forebrain increased width, abnormal gpc4m119/+ + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
whole organism decreased length, abnormal gpc4m119/+ + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
convergent extension involved in gastrulation disrupted, abnormal gpc4m119/+ + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
rhombomere increased width, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
post-vent region decreased length, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
somite increased width, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
forebrain increased width, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
axis increased width, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
whole organism decreased length, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
extension decreased length, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
convergent extension involved in gastrulation disrupted, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
whole organism morphology, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
axis decreased length, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
convergent extension disrupted, abnormal AB + MO1-ptk7b + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 7 from Golubkov et al., 2010
anatomical line ab2-fn labeling increased amount, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. S7 with image from Hu et al., 2018
endoderm cell migration involved in gastrulation process characteristic, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endoderm increased width, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. S7 with image,  Fig. S8 with image from Hu et al., 2018
endoderm convergent extension involved in gastrulation decreased efficacy, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endoderm convergent extension involved in gastrulation process characteristic, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endoderm cell migration involved in gastrulation decreased efficacy, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endoderm increased width, exacerbated gpc4fr6/fr6; ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. S8 with image from Hu et al., 2018
endodermal cell lamellipodium decreased length, abnormal s944Tg; ui10Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endodermal cell lamellipodium decreased life span, abnormal s944Tg; ui10Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endodermal cell lamellipodium decreased amount, abnormal s944Tg; ui10Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endodermal cell plasma membrane bounded cell projection increased amount, abnormal s944Tg; ui10Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
Citations