Morpholino
MO2-mmp14b
- ID
- ZDB-MRPHLNO-081029-5
- Name
- MO2-mmp14b
- Previous Names
- None
- Target
- Sequence
-
5' - GAACCCGCTCCAGATCATTTTTCGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mmp14b
No data available
Phenotype
Phenotype resulting from MO2-mmp14b
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO2-mmp14b
1 - 5 of 50 Show all
Citations
- Hu, B., Gao, Y., Davies, L., Woo, S., Topczewski, J., Jessen, J.R., Lin, F. (2018) Glypican 4 and Mmp14 interact in regulating the migration of anterior endodermal cells by limiting extracellular matrix deposition. Development (Cambridge, England). 145(17):
- Dohn, M.R., Mundell, N.A., Sawyer, L.M., Dunlap, J.A., and Jessen, J.R. (2013) Planar cell polarity proteins differentially regulate extracellular matrix organization and assembly during zebrafish gastrulation. Developmental Biology. 383(1):39-51
- Williams, B.B., Cantrell, V.A., Mundell, N.A., Bennett, A.C., Quick, R.E., and Jessen, J.R. (2012) VANGL2 regulates membrane trafficking of MMP14 to control cell polarity and migration. Journal of Cell Science. 125(9):2141-2147
- Golubkov, V.S., Chekanov, A.V., Cieplak, P., Aleshin, A.E., Chernov, A.V., Zhu, W., Radichev, I.A., Zhang, D., Dong, P.D., and Strongin, A.Y. (2010) The Wnt/planar cell polarity (PCP) protein tyrosine kinase-7 (PTK7) is a highly efficient proteolytic target of membrane type-1 matrix metalloproteinase (MT1-MMP): implications in cancer and embryogenesis. The Journal of biological chemistry. 285(46):35740-35749
- Coyle, R.C., Latimer, A., and Jessen, J.R. (2008) Membrane-type 1 matrix metalloproteinase regulates cell migration during zebrafish gastrulation: Evidence for an interaction with non-canonical Wnt signaling. Experimental cell research. 314(10):2150-2162
1 - 5 of 5
Show