Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-arl6

ID
ZDB-MRPHLNO-081027-3
Name
MO1-arl6
Previous Names
  • bbs3_aug (1)
Target
Sequence
5' - AGCTTGTCAAAAAGCCCCATTTGCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-arl6
Phenotype
Phenotype resulting from MO1-arl6
Phenotype of all Fish created by or utilizing MO1-arl6
Phenotype Fish Conditions Figures
melanosome transport delayed, abnormal WT + MO1-arl6 chemical treatment: (R)-adrenaline Fig. 1 from Tayeh et al., 2008
heart looping disrupted, abnormal WT + MO1-arl6 standard conditions Fig. 1 from Tayeh et al., 2008
visual behavior disrupted, abnormal WT + MO1-arl6 standard conditions Fig. 3 with image from Pretorius et al., 2010
melanosome transport decreased rate, abnormal WT + MO1-arl6 standard conditions Fig. 2 with image from Pretorius et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO1-arl6 standard conditions Fig. 2 with image from Pretorius et al., 2010
Fig. 1 from Tayeh et al., 2008
Kupffer's vesicle aplastic, abnormal WT + MO1-arl6 standard conditions Fig. 1 from Tayeh et al., 2008
determination of left/right symmetry disrupted, abnormal WT + MO1-arl6 standard conditions Fig. 1 from Tayeh et al., 2008
Kupffer's vesicle decreased size, abnormal WT + MO1-arl6 + MO1-bbs2 standard conditions Fig. 2 from Tayeh et al., 2008
melanosome transport delayed, abnormal WT + MO1-arl6 + MO1-bbs2 chemical treatment: (R)-adrenaline Fig. 2 from Tayeh et al., 2008
melanosome transport delayed, abnormal WT + MO1-arl6 + MO1-bbs7 chemical treatment: (R)-adrenaline Fig. 3 from Tayeh et al., 2008
Kupffer's vesicle decreased size, abnormal WT + MO1-arl6 + MO1-bbs7 standard conditions Fig. 3 from Tayeh et al., 2008
visual behavior disrupted, abnormal WT + MO1-arl6 + MO1-crx standard conditions Fig. 3 from Pretorius et al., 2011
melanosome transport delayed, abnormal WT + MO1-arl6 + MO1-crx standard conditions Fig. 2 from Pretorius et al., 2011
Kupffer's vesicle decreased size, abnormal WT + MO1-arl6 + MO2-bbs1 standard conditions Fig. 2 from Tayeh et al., 2008
scapulocoracoid increased thickness, abnormal WT + MO1-arl6 + MO2-bbs1 standard conditions text only from Tayeh et al., 2008
melanosome transport delayed, abnormal WT + MO1-arl6 + MO2-bbs1 chemical treatment: (R)-adrenaline Fig. 2 from Tayeh et al., 2008
Citations