Morpholino

MO5-sox18

ID
ZDB-MRPHLNO-081022-2
Name
MO5-sox18
Previous Names
  • sox18-MO1 (1)
Target
Sequence
5' - TATTCATTCCAGCAAGACCAACACG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
binds to translation start site
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-sox18
No data available
Phenotype
Phenotype resulting from MO5-sox18
Phenotype of all Fish created by or utilizing MO5-sox18
Phenotype Fish Conditions Figures
whole organism sox18 expression increased amount, abnormal WT + MO5-sox18 standard conditions Fig. 9 from Chung et al., 2011
posterior cardinal vein venous blood vessel development process quality, abnormal EKW + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 with image from Swift et al., 2014
whole organism sox18 expression increased amount, abnormal WT + MO5-sox18 + MO5-sox7 standard conditions Fig. 9 from Chung et al., 2011
blood circulation arrested, abnormal WT + MO5-sox18 + MO5-sox7 standard conditions Fig. 3 from Cermenati et al., 2008
whole organism sox7 expression increased amount, abnormal WT + MO5-sox18 + MO5-sox7 standard conditions Fig. 9 from Chung et al., 2011
blood circulation decreased rate, abnormal WT + MO5-sox18 + MO5-sox7 standard conditions Fig. 3 from Cermenati et al., 2008
neutrophil mpx expression decreased amount, abnormal WT + MO5-sox18 + MO5-sox7 standard conditions Fig. 7 from Chung et al., 2011
monocyte mpx expression decreased amount, abnormal WT + MO5-sox18 + MO5-sox7 standard conditions Fig. 7 from Chung et al., 2011
regulation of gene expression disrupted, abnormal WT + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 from Samant et al., 2011
heart edematous, abnormal WT + MO5-sox18 + MO5-sox7 standard conditions Fig. 3 from Cermenati et al., 2008
whole organism lacks all parts of type dorsal aorta, abnormal WT + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 with imageFig. 5 with image from Sacilotto et al., 2013
axial blood vessel decreased amount, abnormal WT + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 5 with image from Sacilotto et al., 2013
artery development arrested, abnormal WT + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 with imageFig. 5 with imageFig. S8 with image from Sacilotto et al., 2013
vasculature development process quality, abnormal y1Tg + MO5-sox18 + MO5-sox7 standard conditions Fig. S3 from Chung et al., 2011
blood vessel development disrupted, abnormal y1Tg + MO5-sox18 + MO5-sox7 standard conditions Fig. 5 with image from Sacilotto et al., 2013
whole organism lacks all parts of type dorsal aorta, abnormal lcr1Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 with image from Sacilotto et al., 2013
artery development arrested, abnormal lcr1Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 with image from Sacilotto et al., 2013
axial blood vessel decreased amount, abnormal y1Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 5 with image from Sacilotto et al., 2013
artery development arrested, abnormal y1Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 5 with image from Sacilotto et al., 2013
blood circulation arrested, abnormal s843Tg; sd2Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. S7 with image from Sacilotto et al., 2013
Citations