Morpholino
MO5-sox7
- ID
- ZDB-MRPHLNO-081022-1
- Name
- MO5-sox7
- Previous Names
-
- sox7-MO1 (1)
- Target
- Sequence
-
5' - ACGCACTTATCAGAGCCGCCATGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
binds to translation start site
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-sox7
No data available
Phenotype
Phenotype resulting from MO5-sox7
| Phenotype | Fish | Figures |
|---|---|---|
| whole organism sox7 expression increased amount, abnormal | WT + MO5-sox7 |
Fig. 9
from Chung et al., 2011 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO5-sox7
from 1 - 5 of 26 Show all
Citations
- Moleri, S., Mercurio, S., Pezzotta, A., D'Angelo, D., Brix, A., Plebani, A., Lini, G., Di Fuorti, M., Beltrame, M. (2023) Lymphatic Defects in Zebrafish sox18 Mutants Are Exacerbated by Perturbed VEGFC Signaling, While Masked by Elevated sox7 Expression. Cells. 12(18):
- Wu, M., Chen, Q., Li, J., Xu, Y., Lian, J., Liu, Y., Meng, P., Zhang, Y. (2022) Gfi1aa/Lsd1 Facilitates Hemangioblast Differentiation Into Primitive Erythrocytes by Targeting etv2 and sox7 in Zebrafish. Frontiers in cell and developmental biology. 9:786426
- Chiang, I.K., Fritzsche, M., Pichol-Thievend, C., Neal, A., Holmes, K., Lagendijk, A., Overman, J., D'Angelo, D., Omini, A., Hermkens, D., Lesieur, E., Liu, K., Ratnayaka, I., Corada, M., Bou-Gharios, G., Carroll, J., Dejana, E., Schulte-Merker, S., Hogan, B., Beltrame, M., De Val, S., Francois, M. (2017) SoxF factors induce Notch1 expression via direct transcriptional regulation during early arterial development. Development (Cambridge, England). 144(14):2629-2639
- Becker, P.W., Sacilotto, N., Nornes, S., Neal, A., Thomas, M., Liu, K., Preece, C., Ratnayaka, I., Davies, B., Bou-Gharios, G., De Val, S. (2016) Intronic Flk1 Enhancer Directs Arterial-Specific Expression via RBPJ-Mediated Venous Repression. Arteriosclerosis, Thrombosis, and Vascular Biology. 36(6):1209-19
- Swift, M.R., Pham, V.N., Castranova, D., Bell, K., Poole, R.J., Weinstein, B.M. (2014) SoxF factors and Notch regulate nr2f2 gene expression during venous differentiation in zebrafish. Developmental Biology. 390:116-25
- Cermenati, S., Moleri, S., Neyt, C., Bresciani, E., Carra, S., Grassini, D.R., Omini, A., Goi, M., Cotelli, F., François, M., Hogan, B.M., and Beltrame, M. (2013) Sox18 Genetically Interacts With VegfC to Regulate Lymphangiogenesis in Zebrafish. Arterioscler. Thromb. Vasc. Biol.. 33(6):1238-47
- Sacilotto, N., Monteiro, R., Fritzsche, M., Becker, P.W., Sanchez-Del-Campo, L., Liu, K., Pinheiro, P., Ratnayaka, I., Davies, B., Goding, C.R., Patient, R., Bou-Gharios, G., and De Val, S. (2013) Analysis of Dll4 regulation reveals a combinatorial role for Sox and Notch in arterial development. Proceedings of the National Academy of Sciences of the United States of America. 110(29):11893-8
- Chung, M.I., Ma, A.C., Fung, T.K., and Leung, A.Y. (2011) Characterization of Sry-related HMG box group F genes in zebrafish hematopoiesis. Experimental hematology. 39(10):986-998.e5
- Samant, G.V., Schupp, M., Francois, M., Moleri, S., Kothinti, R.K., Chun, C.Z., Sinha, I., Sellars, S., Leigh, N., Pramanik, K., Horswill, M.A., Remadevi, I., Li, K., Wilkinson, G.A., Tabatabai, N.M., Beltrame, M., Koopman, P., and Ramchandran, R. (2011) Sox factors transcriptionally regulate ROBO4 expression in developing vasculature in Zebrafish. The Journal of biological chemistry. 286(35):30740-7
- Cermenati, S., Moleri, S., Cimbro, S., Corti, P., Del Giacco, L., Amodeo, R., Dejana, E., Koopman, P., Cotelli, F., and Beltrame, M. (2008) Sox18 and Sox7 play redundant roles in vascular development. Blood. 111(5):2657-2666
1 - 10 of 10
Show