Community Action Needed: Please respond to the NIH RFI
Morpholino

MO2-atp6v0a1a

ID
ZDB-MRPHLNO-081021-2
Name
MO2-atp6v0a1a
Previous Names
  • atp6v0a1-GT-MO (1)
  • MO2-atp6v0a1 (1)
Target
Sequence
5' - GAAATGGTCTGCACTTACATCTCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-atp6v0a1a
No data available
Phenotype
Phenotype resulting from MO2-atp6v0a1a
Phenotype of all Fish created by or utilizing MO2-atp6v0a1a
Citations