Morpholino
MO2-prrc1
- ID
- ZDB-MRPHLNO-080915-2
- Name
- MO2-prrc1
- Previous Names
-
- mys-2SD-MO (1)
- Target
- Sequence
-
5' - CGCATTGGGCATTACCGCTGGTGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-prrc1
Expressed Gene | Anatomy | Figures |
---|---|---|
prkar1aa |
Fig. 4
from Kotani et al., 2010 |
|
prrc1 |
Fig. 4
from Kotani et al., 2010 |
Phenotype
Phenotype resulting from MO2-prrc1
Phenotype of all Fish created by or utilizing MO2-prrc1
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
protein kinase activity decreased occurrence, abnormal | TL + MO2-prrc1 | standard conditions |
Fig. 4
from Kotani et al., 2010 |
whole organism curved ventral, abnormal | WT + MO2-prrc1 | standard conditions |
Fig. 4 ![]() |
Citations
- Kotani, T., Iemura, S.I., Natsume, T., Kawakami, K., and Yamashita, M. (2010) Mys protein regulates protein kinase A activity by interacting with regulatory type I{alpha} subunit during vertebrate development. The Journal of biological chemistry. 285(7):5106-5116
- Kotani, T., and Kawakami, K. (2008) misty somites, a maternal effect gene identified by transposon-mediated insertional mutagenesis in zebrafish that is essential for the somite boundary maintenance. Developmental Biology. 316(2):383-396
1 - 2 of 2
Show