ZFIN ID: ZDB-MRPHLNO-080912-1
Morpholino Name: MO1-desi2
Target: desi2 (1)
Previous Names: MO1-fam152a, MO1-pppde1, ZPnas4-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CAGGATAACCGGCTCGTTTGCCATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-desi2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-desi2
Expressed Gene Anatomy Figures
ctslb Fig. 5 from Yao et al., 2008
dlx3b Fig. 5 from Yao et al., 2008
gsc Fig. 5 from Yao et al., 2008
myod1 Fig. 5 from Yao et al., 2008
pcdh8 Fig. 5 from Yao et al., 2008
tbxta Fig. 5 from Yao et al., 2008
PHENOTYPE
Phenotype resulting from MO1-desi2
Phenotype of all Fish created by or utilizing MO1-desi2
Phenotype Fish Conditions Figures
prechordal plate mislocalised, abnormal TU + MO1-desi2 standard conditions Fig. 3Fig. 5 from Yao et al., 2008
post-vent region curved ventral, abnormal TU + MO1-desi2 standard conditions Fig. 3 from Yao et al., 2008
polster mislocalised, abnormal TU + MO1-desi2 standard conditions Fig. 5 from Yao et al., 2008
post-vent region decreased length, abnormal TU + MO1-desi2 standard conditions Fig. 3 from Yao et al., 2008
axis increased width, abnormal TU + MO1-desi2 standard conditions Fig. 3 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal TU + MO1-desi2 standard conditions Fig. 5 from Yao et al., 2008
axis decreased length, abnormal TU + MO1-desi2 standard conditions Fig. 3Fig. 5 from Yao et al., 2008
post-anal tail morphogenesis disrupted, abnormal TU + MO1-desi2 standard conditions Fig. 3 from Yao et al., 2008
gastrulation disrupted, abnormal TU + MO1-desi2 standard conditions Fig. 3Fig. 5 from Yao et al., 2008
neural plate increased width, abnormal TU + MO1-desi2 standard conditions Fig. 5 from Yao et al., 2008
notochord increased width, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
post-anal tail morphogenesis disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
axis decreased length, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
convergent extension involved in axis elongation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
post-vent region decreased length, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
gastrulation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
Genome Resources:
CITATIONS (1)