ZFIN ID: ZDB-MRPHLNO-080721-1
Morpholino Name: MO2-gemin2
Target: gemin2 (1)
Previous Name: MO2-sip1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CAACTCCTCGGCGTCTGACTTCATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-gemin2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-gemin2
Expressed Gene Anatomy Figures
gemin2 Fig. 1 from McWhorter et al., 2008
PHENOTYPE
Phenotype resulting from MO2-gemin2
Phenotype Figures
embryo development disrupted, abnormal Fig. 1 from McWhorter et al., 2008
motor neuron axon branched, abnormal Fig. 2 from McWhorter et al., 2008
motor neuron axon truncated, abnormal Fig. 2 from McWhorter et al., 2008
Rohon-Beard neuron decreased amount, abnormal Fig. 3 from McWhorter et al., 2008
trigeminal ganglion axon decreased amount, abnormal Fig. 3 from McWhorter et al., 2008
whole organism decreased size, abnormal Fig. 1 from McWhorter et al., 2008
whole organism morphology, abnormal Fig. 1 from McWhorter et al., 2008

Phenotype of all Fish created by or utilizing MO2-gemin2
Phenotype Fish Conditions Figures
trigeminal ganglion axon decreased amount, abnormal AB + MO2-gemin2 standard conditions Fig. 3 from McWhorter et al., 2008
embryo development disrupted, abnormal AB + MO2-gemin2 standard conditions Fig. 1 from McWhorter et al., 2008
motor neuron axon truncated, abnormal AB + MO2-gemin2 standard conditions Fig. 2 from McWhorter et al., 2008
whole organism morphology, abnormal AB + MO2-gemin2 standard conditions Fig. 1 from McWhorter et al., 2008
whole organism decreased size, abnormal AB + MO2-gemin2 standard conditions Fig. 1 from McWhorter et al., 2008
Rohon-Beard neuron decreased amount, abnormal AB + MO2-gemin2 standard conditions Fig. 3 from McWhorter et al., 2008
motor neuron axon branched, abnormal AB + MO2-gemin2 standard conditions Fig. 2 from McWhorter et al., 2008
OTHER MO2-gemin2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)