Morpholino

MO1-gli2b

ID

ZDB-MRPHLNO-080703-4

Name

MO1-gli2b

Previous Names

gli2bATG (1)

Target

gli2b (1)

Sequence

5' - CGGGAGCTGGAACACCGGCCTCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a translation blocking morpholino that targets gli2b.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gli2b

Expressed Gene	Anatomy	Figures
alcama	(not) abducens motor nucleus (not) secondary motor neuron	Fig. 5 from Ke et al., 2008
dnajc2	astrocyte hindbrain	Fig. 1 from Ke et al., 2008
egr2b	rhombomere 3 rhombomere 5	Fig. S2 from Ke et al., 2008
gfap	astrocyte hindbrain	Fig. 1 from Ke et al., 2008
hoxa2b	rhombomere 2 rhombomere 3 rhombomere 4 rhombomere 5	Fig. S2 from Ke et al., 2008
hoxb3a	rhombomere 5 rhombomere 6 rhombomere 7	Fig. S2 from Ke et al., 2008
mafba	rhombomere 5 rhombomere 6	Fig. S2 from Ke et al., 2008
neurod4	hindbrain	Fig. 2 from Ke et al., 2008
neurog1	hindbrain	Fig. 3 from Ke et al., 2008
nkx2.2a	hindbrain rhombomere	Fig. 6 from Ke et al., 2008
notch1a	hindbrain	Fig. 3 from Ke et al., 2008
notch1b	hindbrain	Fig. 3 from Ke et al., 2008
ntn1a	floor plate rhombomere region rhombomere 4	Fig. 6 from Ke et al., 2008
olig2	(not) hindbrain	Fig. 4 from Ke et al., 2008

Phenotype

Phenotype resulting from MO1-gli2b

Phenotype	Fish	Figures
abducens motor nucleus aplastic, abnormal	WT + MO1-gli2b	Fig. 5 from Ke et al., 2008
axonogenesis disrupted, abnormal	WT + MO1-gli2b	Fig. S2 from Ke et al., 2008
brain decreased size, abnormal	WT + MO1-gli2b	text only from Ke et al., 2008
facial nerve motor nucleus mislocalised laterally, abnormal	WT + MO1-gli2b	Fig. 5 from Ke et al., 2008
floor plate formation disrupted, abnormal	WT + MO1-gli2b	Fig. 6 from Ke et al., 2008
floor plate rhombomere region increased width, abnormal	WT + MO1-gli2b	Fig. 6 from Ke et al., 2008
fourth ventricle increased size, abnormal	WT + MO1-gli2b	text only from Ke et al., 2008
hindbrain astrocyte decreased amount, abnormal	WT + MO1-gli2b	Fig. 1 from Ke et al., 2008
oligodendrocyte differentiation disrupted, abnormal	WT + MO1-gli2b	Fig. 4 from Ke et al., 2008
Rohon-Beard neuron decreased amount, abnormal	WT + MO1-gli2b	Fig. 5 from Ke et al., 2008
secondary motor neuron decreased amount, abnormal	WT + MO1-gli2b	Fig. 5 from Ke et al., 2008
trigeminal motor nucleus mislocalised laterally, abnormal	WT + MO1-gli2b	Fig. 5 from Ke et al., 2008

Phenotype of all Fish created by or utilizing MO1-gli2b

Phenotype	Fish	Conditions	Figures
floor plate formation disrupted, abnormal	WT + MO1-gli2b	standard conditions	Fig. 6 from Ke et al., 2008
hindbrain astrocyte decreased amount, abnormal	WT + MO1-gli2b	standard conditions	Fig. 1 from Ke et al., 2008
oligodendrocyte differentiation disrupted, abnormal	WT + MO1-gli2b	standard conditions	Fig. 4 from Ke et al., 2008
facial nerve motor nucleus mislocalised laterally, abnormal	WT + MO1-gli2b	standard conditions	Fig. 5 from Ke et al., 2008
Rohon-Beard neuron decreased amount, abnormal	WT + MO1-gli2b	standard conditions	Fig. 5 from Ke et al., 2008
axonogenesis disrupted, abnormal	WT + MO1-gli2b	standard conditions	Fig. S2 from Ke et al., 2008
secondary motor neuron decreased amount, abnormal	WT + MO1-gli2b	standard conditions	Fig. 5 from Ke et al., 2008
fourth ventricle increased size, abnormal	WT + MO1-gli2b	standard conditions	text only from Ke et al., 2008
abducens motor nucleus aplastic, abnormal	WT + MO1-gli2b	standard conditions	Fig. 5 from Ke et al., 2008
brain decreased size, abnormal	WT + MO1-gli2b	standard conditions	text only from Ke et al., 2008
floor plate rhombomere region increased width, abnormal	WT + MO1-gli2b	standard conditions	Fig. 6 from Ke et al., 2008
trigeminal motor nucleus mislocalised laterally, abnormal	WT + MO1-gli2b	standard conditions	Fig. 5 from Ke et al., 2008
floor plate formation disrupted, abnormal	gli2a^ty17a/ty17a + MO1-gli2b	standard conditions	Fig. 6 from Ke et al., 2008
facial nerve motor nucleus decreased amount, abnormal	gli2a^ty17a/ty17a + MO1-gli2b	standard conditions	Fig. 5 from Ke et al., 2008
vagal lobe aplastic, abnormal	gli2a^ty17a/ty17a + MO1-gli2b	standard conditions	Fig. 5 from Ke et al., 2008
Rohon-Beard neuron decreased amount, abnormal	gli2a^ty17a/ty17a + MO1-gli2b	standard conditions	Fig. 5 from Ke et al., 2008
trigeminal motor nucleus aplastic, abnormal	gli2a^ty17a/ty17a + MO1-gli2b	standard conditions	Fig. 5 from Ke et al., 2008

Citations