Morpholino

MO2-cep290

ID
ZDB-MRPHLNO-080428-3
Name
MO2-cep290
Previous Names
  • spMO (1)
Target
Sequence
5' - AAAGTTGCACCTACAGAGGGTCTGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cep290
No data available
Phenotype
Phenotype resulting from MO2-cep290
Phenotype Fish Figures
axis curved ventral, abnormal AB/TU + MO2-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
brain decreased mass, abnormal WT + MO2-cep290 Fig. 3 from Sayer et al., 2006
eye decreased size, abnormal WT + MO2-cep290 Fig. 3 from Sayer et al., 2006
eye malformed, abnormal WT + MO2-cep290 Fig. 3 from Sayer et al., 2006
heart determination of heart left/right asymmetry process quality, abnormal AB/TU + MO2-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
kidney cystic, abnormal AB/TU + MO2-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
nervous system development disrupted, abnormal WT + MO2-cep290 Fig. 3 from Sayer et al., 2006
otic vesicle decreased size, abnormal WT + MO2-cep290 Fig. 3 from Sayer et al., 2006
otic vesicle formation disrupted, abnormal WT + MO2-cep290 Fig. 3 from Sayer et al., 2006
otolith amount, abnormal AB/TU + MO2-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
post-vent region curved ventral, abnormal AB/TU + MO2-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
Phenotype of all Fish created by or utilizing MO2-cep290
Phenotype Fish Conditions Figures
otolith amount, abnormal AB/TU + MO2-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
post-vent region curved ventral, abnormal AB/TU + MO2-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
heart determination of heart left/right asymmetry process quality, abnormal AB/TU + MO2-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
axis curved ventral, abnormal AB/TU + MO2-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
kidney cystic, abnormal AB/TU + MO2-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
nervous system development disrupted, abnormal WT + MO2-cep290 standard conditions Fig. 3 from Sayer et al., 2006
otic vesicle formation disrupted, abnormal WT + MO2-cep290 standard conditions Fig. 3 from Sayer et al., 2006
eye malformed, abnormal WT + MO2-cep290 standard conditions Fig. 3 from Sayer et al., 2006
eye decreased size, abnormal WT + MO2-cep290 standard conditions Fig. 3 from Sayer et al., 2006
otic vesicle decreased size, abnormal WT + MO2-cep290 standard conditions Fig. 3 from Sayer et al., 2006
brain decreased mass, abnormal WT + MO2-cep290 standard conditions Fig. 3 from Sayer et al., 2006
pronephros cystic, abnormal cc2d2aw38/w38 + MO2-cep290 (AB) standard conditions text only from Gorden et al., 2008
pronephros cystic, exacerbated cc2d2aw38/w38 + MO2-cep290 (AB) standard conditions Fig. 6 from Gorden et al., 2008
pericardium edematous, abnormal cc2d2aw38/w38 + MO2-cep290 (AB) standard conditions Fig. 6 from Gorden et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.