Morpholino
MO1-cep290
- ID
- ZDB-MRPHLNO-080428-2
- Name
- MO1-cep290
- Previous Names
-
- ATG-MO (1)
- MO6-cep290
- Target
- Sequence
-
5' - GCCGCAGGCATTCTTCAGGTCAGCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cep290
No data available
Phenotype
Phenotype resulting from MO1-cep290
1 - 5 of 27 Show all
Phenotype of all Fish created by or utilizing MO1-cep290
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| axis curved, abnormal | AB/TU + MO1-cep290 | control |
Fig. 1. 
from Cardenas-Rodriguez et al., 2021 |
| otolith amount, abnormal | AB/TU + MO1-cep290 | control |
Fig. S1
from Cardenas-Rodriguez et al., 2021 |
| kidney cystic, abnormal | AB/TU + MO1-cep290 | control |
Fig. S1
from Cardenas-Rodriguez et al., 2021 |
| axis curved ventral, abnormal | AB/TU + MO1-cep290 | control |
Fig. S1
from Cardenas-Rodriguez et al., 2021 |
| heart determination of heart left/right asymmetry process quality, abnormal | AB/TU + MO1-cep290 | control |
Fig. S1
from Cardenas-Rodriguez et al., 2021 |
1 - 5 of 35 Show all
Citations
- Cardenas-Rodriguez, M., Austin-Tse, C., Bergboer, J.G.M., Molinari, E., Sugano, Y., Bachmann-Gagescu, R., Sayer, J.A., Drummond, I.A. (2021) Genetic compensation for cilia defects in cep290/NPHP6 mutants by upregulation of cilia-associated small GTPases. Journal of Cell Science. 134(14):
- Slaats, G.G., Saldivar, J.C., Bacal, J., Zeman, M.K., Kile, A.C., Hynes, A.M., Srivastava, S., Nazmutdinova, J., Ouden, K.D., Zagers, M.S., Foletto, V., Verhaar, M.C., Miles, C., Sayer, J.A., Cimprich, K.A., Giles, R.H. (2015) DNA replication stress underlies renal phenotypes in CEP290-associated Joubert syndrome. The Journal of Clinical Investigation. 125(9):3657-66
- Rachel, R.A., May-Simera, H.L., Veleri, S., Gotoh, N., Choi, B.Y., Murga-Zamalloa, C., McIntyre, J.C., Marek, J., Lopez, I., Hackett, A.N., Brooks, M., den Hollander, A.I., Beales, P.L., Li, T., Jacobson, S.G., Sood, R., Martens, J.R., Liu, P., Friedman, T.B., Khanna, H., Koenekoop, R.K., Kelley, M.W., and Swaroop, A. (2012) Combining Cep290 and Mkks ciliopathy alleles in mice rescues sensory defects and restores ciliogenesis. J. Clin. Invest.. 122(4):1233-1245
- Murga-Zamalloa, C.A., Ghosh, A.K., Patil, S.B., Reed, N.A., Chan, L.S., Davuluri, S., Peranen, J., Hurd, T.W., Rachel, R.A., and Khanna, H. (2011) Accumulation of RAF-1 kinase inhibitory protein (RKIP) is associated with CEP290-mediated photoreceptor degeneration in ciliopathies. The Journal of biological chemistry. 286(32):28276-86
- Gorden, N.T., Arts, H.H., Parisi, M.A., Coene, K.L., Letteboer, S.J., van Beersum, S.E., Mans, D.A., Hikida, A., Eckert, M., Knutzen, D., Alswaid, A.F., Ozyurek, H., Dibooglu, S., Otto, E.A., Liu, Y., Davis, E.E., Hutter, C.M., Bammler, T.K., Farin, F.M., Dorschner, M., Topçu, M., Zackai, E.H., Rosenthal, P., Owens, K.N., Katsanis, N., Vincent, J.B., Hildebrandt, F., Rubel, E.W., Raible, D.W., Knoers, N.V., Chance, P.F., Roepman, R., Moens, C.B., Glass, I.A., and Doherty, D. (2008) CC2D2A Is Mutated in Joubert Syndrome and Interacts with the Ciliopathy-Associated Basal Body Protein CEP290. American journal of human genetics. 83(5):559-571
- Sayer, J.A., Otto, E.A., O'toole, J.F., Nurnberg, G., Kennedy, M.A., Becker, C., Hennies, H.C., Helou, J., Attanasio, M., Fausett, B.V., Utsch, B., Khanna, H., Liu, Y., Drummond, I., Kawakami, I., Kusakabe, T., Tsuda, M., Ma, L., Lee, H., Larson, R.G., Allen, S.J., Wilkinson, C.J., Nigg, E.A., Shou, C., Lillo, C., Williams, D.S., Hoppe, B., Kemper, M.J., Neuhaus, T., Parisi, M.A., Glass, I.A., Petry, M., Kispert, A., Gloy, J., Ganner, A., Walz, G., Zhu, X., Goldman, D., Nurnberg, P., Swaroop, A., Leroux, M.R., and Hildebrandt, F. (2006) The centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor ATF4. Nature Genetics. 38(6):674-681
1 - 6 of 6
Show