Morpholino
MO3-psen1
- ID
- ZDB-MRPHLNO-080421-1
- Name
- MO3-psen1
- Previous Names
- Target
- Sequence
-
5' - ACTAAATCAGCCATCGGAACTGTGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-psen1
No data available
Phenotype
Phenotype resulting from MO3-psen1
1 - 5 of 19 Show all
Phenotype of all Fish created by or utilizing MO3-psen1
1 - 5 of 27 Show all
Citations
- Newman, M., Halter, L., Lim, A., Lardelli, M. (2017) Mitochondrion to endoplasmic reticulum apposition length in zebrafish embryo spinal progenitors is unchanged in response to perturbations associated with Alzheimer's disease. PLoS One. 12:e0179859
- Newman, M., Wilson, L., Verdile, G., Lim, A., Khan, I., Moussavi Nik, S.H., Pursglove, S., Chapman, G., Martins, R.N., and Lardelli, M. (2014) Differential, dominant activation and inhibition of Notch signalling and APP cleavage by truncations of PSEN1 in human disease. Human molecular genetics. 23(3):602-17
- Wilson, L., and Lardelli, M. (2013) The Development of an in vivo gamma-Secretase Assay using Zebrafish Embryos. Journal of Alzheimer's disease : JAD. 36(3):521-34
- Nornes, S., Newman, M., Wells, S., Verdile, G., Martins, R.N., and Lardelli, M. (2009) Independent and cooperative action of Psen2 with Psen1 in zebrafish embryos. Experimental cell research. 315(16):2791-2801
- Nornes, S., Newman, M., Verdile, G., Wells, S., Stoick-Cooper, C., Tucker, B., Frederich-Sleptsova, I., Martins, R., and Lardelli, M. (2008) Interference with splicing of Presenilin transcripts has potent dominant negative effects on Presenilin activity. Human molecular genetics. 17(3):402-412
- Nornes, S., Groth, C., Camp, E., Ey, P., and Lardelli, M. (2003) Developmental control of Presenilin1 expression, endoproteolysis, and interaction in zebrafish embryos. Experimental cell research. 289(1):124-132
1 - 6 of 6
Show