Morpholino
MO3-smad3b
- ID
- ZDB-MRPHLNO-080313-8
- Name
- MO3-smad3b
- Previous Names
-
- smad3b-MO2 (1)
- Target
- Sequence
-
5' - TTGTCCACGAGTCACATCACCGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-smad3b
No data available
Phenotype
Phenotype resulting from MO3-smad3b
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO3-smad3b
1 - 5 of 7 Show all
Citations
- Casari, A., Schiavone, M., Facchinello, N., Vettori, A., Meyer, D., Tiso, N., Moro, E., Argenton, F. (2014) A Smad3 transgenic reporter reveals TGF-beta control of zebrafish spinal cord development. Developmental Biology. 396(1):81-93
- Liu, Z., Lin, X., Cai, Z., Zhang, Z., Han, C., Jia, S., Meng, A., and Wang, Q. (2011) Global identification of SMAD2 target genes reveals a role for multiple co-regulatory factors in zebrafish early gastrulas. The Journal of biological chemistry. 286(32):28520-32
- Jia, S., Ren, Z., Li, X., Zheng, Y., and Meng, A. (2008) smad2 and smad3 Are Required for Mesendoderm Induction by Transforming Growth Factor-β/Nodal Signals in Zebrafish. The Journal of biological chemistry. 283(4):2418-2426
1 - 3 of 3
Show