Morpholino

MO1-ift70

ID
ZDB-MRPHLNO-080107-2
Name
MO1-ift70
Previous Names
  • MO1-flr
  • flrMoex9d (1)
Target
Sequence
5' - TAGTACACTTACCTCATATTTACAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ift70
No data available
Phenotype
Phenotype resulting from MO1-ift70
Phenotype of all Fish created by or utilizing MO1-ift70
Phenotype Fish Conditions Figures
Kupffer's vesicle cilium decreased amount, abnormal AB/TU + MO1-ift70 standard conditions Fig. 5 from Pathak et al., 2007
pronephros cystic, abnormal AB/TU + MO1-ift70 standard conditions Fig. 3 from Pathak et al., 2007
Kupffer's vesicle cilium decreased length, abnormal AB/TU + MO1-ift70 standard conditions Fig. 5 from Pathak et al., 2007
whole organism anterior-posterior axis curved ventral, abnormal AB/TU + MO1-ift70 standard conditions Fig. 3 from Pathak et al., 2007
determination of left/right symmetry disrupted, abnormal AB/TU + MO1-ift70 standard conditions Fig. 6 from Pathak et al., 2007
pronephros axoneme structure, abnormal AB/TU + MO1-ift70 standard conditions Fig. 7 from Pathak et al., 2007
cilium assembly disrupted, abnormal AB/TU + MO1-ift70 standard conditions Fig. 5 from Pathak et al., 2007
pronephric duct microtubule disorganized, abnormal AB/TU + MO1-ift70 standard conditions Fig. 7 from Pathak et al., 2007
protein localization to cilium disrupted, abnormal WT + MO1-ift70 standard conditions Fig. 5 from Zhao et al., 2011
neuromast hair cell disoriented, abnormal WT + MO1-ift70 + MO1-vangl2 standard conditions Fig. 7 from Zhao et al., 2011
establishment of planar polarity disrupted, abnormal WT + MO1-ift70 + MO1-vangl2 standard conditions Fig. 7 from Zhao et al., 2011
spinal cord cilium decreased length, abnormal WT + MO1-ift70 + MO2-b9d2 standard conditions Fig. 2 from Zhao et al., 2011
opsin transport disrupted, abnormal WT + MO1-ift70 + MO2-b9d2 standard conditions Fig. 6 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal WT + MO1-ift70 + MO2-b9d2 standard conditions Fig. 6Fig. S4 from Zhao et al., 2011
olfactory pit cilium decreased length, abnormal WT + MO1-ift70 + MO2-b9d2 standard conditions Fig. 2Fig. S4 from Zhao et al., 2011
protein localization to cilium disrupted, abnormal WT + MO1-ift70 + MO2-b9d2 standard conditions Fig. 5 from Zhao et al., 2011
determination of left/right symmetry disrupted, abnormal WT + MO1-ift70 + MO2-b9d2 standard conditions Fig. 6 from Zhao et al., 2011
determination of left/right symmetry disrupted, abnormal WT + MO1-ift70 + MO2-ift52 standard conditions Fig. 6 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal WT + MO1-ift70 + MO2-ift52 standard conditions Fig. 6 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal WT + MO1-ift70 + MO2-invs standard conditions Fig. 6 from Zhao et al., 2011
opsin transport disrupted, abnormal WT + MO1-ift70 + MO2-invs standard conditions Fig. 6 from Zhao et al., 2011
Citations