Morpholino

MO1-ift46

ID

ZDB-MRPHLNO-080102-1

Name

MO1-ift46

Previous Names

None

Target

Sequence

5' - GGTGCTCTGCTTCTGCCTACCCGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ift46

Expressed Gene	Anatomy	Figures
col2a1a	floor plate hypochord notochord	Fig. 10 from Gouttenoire et al., 2007
eve1	post-vent region	Fig. 10 from Gouttenoire et al., 2007

Phenotype

Phenotype resulting from MO1-ift46

Phenotype	Fish	Figures
post-vent region curved dorsal, abnormal	WT + MO1-ift46	Fig. 9 from Gouttenoire et al., 2007
post-vent region decreased length, abnormal	WT + MO1-ift46	Fig. 9 from Gouttenoire et al., 2007
post-vent region mislocalised, abnormal	AB/TU + MO1-ift46	Fig. 9, Fig. 10 from Gouttenoire et al., 2007
post-vent region structure, abnormal	WT + MO1-ift46	Fig. 9 from Gouttenoire et al., 2007
pronephros cystic, abnormal	AB + MO1-ift46	Fig. 3 from Lee et al., 2020
whole organism has extra parts of type post-vent region, abnormal	AB/TU + MO1-ift46	Fig. 9, Fig. 10 from Gouttenoire et al., 2007
whole organism ovate, abnormal	WT + MO1-ift46	Fig. 9 from Gouttenoire et al., 2007
whole organism wholly dorsalized, abnormal	WT + MO1-ift46	Fig. 9 from Gouttenoire et al., 2007

Phenotype of all Fish created by or utilizing MO1-ift46

Phenotype	Fish	Conditions	Figures
pronephros cystic, abnormal	AB + MO1-ift46	standard conditions	Fig. 3 from Lee et al., 2020
post-vent region mislocalised, abnormal	AB/TU + MO1-ift46	standard conditions	Fig. 10 from Gouttenoire et al., 2007
whole organism has extra parts of type post-vent region, abnormal	AB/TU + MO1-ift46	standard conditions	Fig. 10 from Gouttenoire et al., 2007
whole organism has extra parts of type post-vent region, abnormal	WT + MO1-ift46	standard conditions	Fig. 9 from Gouttenoire et al., 2007
post-vent region decreased length, abnormal	WT + MO1-ift46	standard conditions	Fig. 9 from Gouttenoire et al., 2007
whole organism ovate, abnormal	WT + MO1-ift46	standard conditions	Fig. 9 from Gouttenoire et al., 2007
post-vent region mislocalised, abnormal	WT + MO1-ift46	standard conditions	Fig. 9 from Gouttenoire et al., 2007
post-vent region structure, abnormal	WT + MO1-ift46	standard conditions	Fig. 9 from Gouttenoire et al., 2007
whole organism wholly dorsalized, abnormal	WT + MO1-ift46	standard conditions	Fig. 9 from Gouttenoire et al., 2007
post-vent region curved dorsal, abnormal	WT + MO1-ift46	standard conditions	Fig. 9 from Gouttenoire et al., 2007

Citations