Morpholino

MO1-znf148

ID

ZDB-MRPHLNO-071227-1

Name

MO1-znf148

Previous Names

Target

Sequence

5' - CCTCCAGCTTGTCATCAATGTTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-znf148

Expressed Gene	Anatomy	Figures
cdx4	intermediate cell mass of mesoderm	Fig. 1 from Li et al., 2006
gata1a	intermediate cell mass of mesoderm	Fig. 2 from Li et al., 2006
gata2a	brain intermediate cell mass of mesoderm trunk ganglion	Fig. 1 from Li et al., 2006
kdrl	anterior lateral mesoderm intermediate cell mass of mesoderm	Fig. 2 from Li et al., 2006
lcp1	myeloid lineage restricted progenitor cell	Fig. 2 from Li et al., 2006
lmo2	intermediate cell mass of mesoderm	Fig. 1 from Li et al., 2006
mpx	myeloid lineage restricted progenitor cell	Fig. 2 from Li et al., 2006
myb	head intermediate cell mass of mesoderm ventral wall of dorsal aorta	Fig. 2 from Li et al., 2006
runx1	head intermediate cell mass of mesoderm ventral wall of dorsal aorta	Fig. 2 from Li et al., 2006
spi1b	macrophage myeloid lineage restricted progenitor cell	Fig. 2 from Li et al., 2006
tal1	anterior lateral mesoderm intermediate cell mass of mesoderm	Fig. 1 from Li et al., 2006
trim33	central nervous system intermediate cell mass of mesoderm	Fig. 2 from Li et al., 2006

Phenotype

Phenotype resulting from MO1-znf148

Phenotype	Fish	Figures
blood nucleate erythrocyte absent, abnormal	WT + MO1-znf148	Fig. 1 , Fig. 4 from Li et al., 2006
hemopoiesis disrupted, abnormal	WT + MO1-znf148	Fig. 1 from Li et al., 2006
pericardium edematous, abnormal	WT + MO1-znf148	Fig. 4 from Li et al., 2006
whole organism lethal (sensu genetics), abnormal	WT + MO1-znf148	text only from Li et al., 2006
whole organism anterior-posterior axis deformed, abnormal	WT + MO1-znf148	text only from Li et al., 2006

Phenotype of all Fish created by or utilizing MO1-znf148

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	WT + MO1-znf148	standard conditions	Fig. 4 from Li et al., 2006
hemopoiesis disrupted, abnormal	WT + MO1-znf148	standard conditions	Fig. 1 from Li et al., 2006
whole organism anterior-posterior axis deformed, abnormal	WT + MO1-znf148	standard conditions	text only from Li et al., 2006
blood nucleate erythrocyte absent, abnormal	WT + MO1-znf148	standard conditions	Fig. 1 , Fig. 4 from Li et al., 2006
whole organism lethal (sensu genetics), abnormal	WT + MO1-znf148	standard conditions	text only from Li et al., 2006
blood nucleate erythrocyte absent, abnormal	la781Tg + MO1-znf148	standard conditions	Fig. 4 from Li et al., 2006

Citations