ZFIN ID: ZDB-MRPHLNO-071226-1
Morpholino Name: MO3-ptger4a
Target: ptger4a (1)
Previous Name: ep4a-MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GATCGCGCTAAGCAGGCATTTTATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-ptger4a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-ptger4a
Expressed Gene Anatomy Figures
gata1a Fig. 5 from Villablanca et al., 2007
ikzf1 Fig. 5 from Villablanca et al., 2007
rag1 Fig. T1 from Villablanca et al., 2007
tal1 Fig. 5 from Villablanca et al., 2007
PHENOTYPE
Phenotype resulting from MO3-ptger4a
No data available

Phenotype of all Fish created by or utilizing MO3-ptger4a
No data available
OTHER MO3-ptger4a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)