Morpholino

MO1-tob1a

ID

ZDB-MRPHLNO-071205-3

Name

MO1-tob1a

Previous Names

Target

Sequence

5' - TCAAGCTGCATAGCTGCTGCGCTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tob1a

Expressed Gene	Anatomy	Figures
bmp2b	whole organism	Fig. 2 from Xiong et al., 2006
chrd	germ ring organizer inducing center presumptive dorsal mesoderm shield	Fig. 2 , Fig. 5 , Fig. S4 from Xiong et al., 2006
dharma	organizer inducing center	Fig. 5 from Xiong et al., 2006
eve1	whole organism	Fig. 2 from Xiong et al., 2006
gata1a	intermediate cell mass of mesoderm	Fig. 2 from Xiong et al., 2006
gata2a	whole organism	Fig. 2 from Xiong et al., 2006
gsc	shield	Fig. 2 from Xiong et al., 2006
hoxb1b	neural plate	Fig. 5 from Xiong et al., 2006
otx2b	neuroectoderm	Fig. 2 , Fig. 5 from Xiong et al., 2006
sox17	endoderm	Fig. S11 from Xiong et al., 2006
sox32	presumptive endoderm	Fig. S11 from Xiong et al., 2006
tbx16l	ventral mesoderm	Fig. 5 from Xiong et al., 2006
tbxta	presumptive mesoderm	Fig. S11 from Xiong et al., 2006

Phenotype

Phenotype resulting from MO1-tob1a

Phenotype	Fish	Figures
dorsal/ventral pattern formation disrupted, abnormal	TU + MO1-tob1a	Fig. 2 , Fig. S1 from Xiong et al., 2006
post-vent region decreased length, abnormal	TU + MO1-tob1a	Fig. 2 from Xiong et al., 2006
post-vent region kinked, abnormal	TU + MO1-tob1a	Fig. 2 from Xiong et al., 2006
post-vent region malformed, abnormal	TU + MO1-tob1a	Fig. S1 from Xiong et al., 2006
tail bud umbonate, abnormal	TU + MO1-tob1a	Fig. 2 from Xiong et al., 2006
ventral fin fold decreased size, abnormal	TU + MO1-tob1a	Fig. 2 from Xiong et al., 2006
whole organism wholly dorsalized, abnormal	TU + MO1-tob1a	Fig. 2 , Fig. S1 from Xiong et al., 2006

Phenotype of all Fish created by or utilizing MO1-tob1a

Phenotype	Fish	Conditions	Figures
whole organism wholly dorsalized, abnormal	TU + MO1-tob1a	standard conditions	Fig. 2 , Fig. S1 from Xiong et al., 2006
tail bud umbonate, abnormal	TU + MO1-tob1a	standard conditions	Fig. 2 from Xiong et al., 2006
post-vent region malformed, abnormal	TU + MO1-tob1a	standard conditions	Fig. S1 from Xiong et al., 2006
dorsal/ventral pattern formation disrupted, abnormal	TU + MO1-tob1a	standard conditions	Fig. 2 , Fig. S1 from Xiong et al., 2006
post-vent region kinked, abnormal	TU + MO1-tob1a	standard conditions	Fig. 2 from Xiong et al., 2006
ventral fin fold decreased size, abnormal	TU + MO1-tob1a	standard conditions	Fig. 2 from Xiong et al., 2006
post-vent region decreased length, abnormal	TU + MO1-tob1a	standard conditions	Fig. 2 from Xiong et al., 2006

Citations