Morpholino

MO1-cd2ap

ID

ZDB-MRPHLNO-071114-1

Name

MO1-cd2ap

Previous Names

MO1-cd2apl

Target

cd2ap (1)

Sequence

5' - CATACTCCACCACCACCTCAACCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cd2ap

Expressed Gene	Anatomy	Figures
ctnnb1	whole organism	Fig. 7 from Kuusela et al., 2016
nphs2	whole organism	Fig. 7 from Kuusela et al., 2016

Phenotype

Phenotype resulting from MO1-cd2ap

Phenotype	Fish	Figures
glomerular filtration disrupted, abnormal	AB + MO1-cd2ap	Fig. S8 from Schiffer et al., 2015 Fig. S4 from Yeo et al., 2015 Fig. 3 from Hentschel et al., 2007
ocular blood vessel EGFP expression decreased amount, abnormal	lri500Tg + MO1-cd2ap	Fig. 4 from Tossidou et al., 2019
pericardium edematous, abnormal	WT + MO1-cd2ap	Fig. 7 from Kuusela et al., 2016 Fig. 1 from Hentschel et al., 2007
podocyte structure, abnormal	AB + MO1-cd2ap	Fig. 1 from Hentschel et al., 2007
podocyte development disrupted, abnormal	WT + MO1-cd2ap + MO4-tp53	Fig. S4 from Yeo et al., 2015
pronephric glomerular basement membrane increased permeability, abnormal	WT + MO1-cd2ap + MO4-tp53	Fig. S4 from Yeo et al., 2015
pronephric glomerular capillary distended, abnormal	WT + MO1-cd2ap	Fig. 7 from Kuusela et al., 2016
pronephric glomerulus morphology, abnormal	WT + MO1-cd2ap	Fig. 7 from Kuusela et al., 2016
protein poly-ADP-ribosylation increased occurrence, abnormal	WT + MO1-cd2ap	Fig. 7 from Kuusela et al., 2016
whole organism nphs2 expression decreased amount, abnormal	WT + MO1-cd2ap	Fig. 7 from Kuusela et al., 2016
whole organism decreased life span, abnormal	AB + MO1-cd2ap	Fig. S8 from Schiffer et al., 2015
whole organism edematous, abnormal	lri500Tg + MO1-cd2ap	Fig. 4 from Tossidou et al., 2019
whole organism ctnnb1 expression increased amount, abnormal	WT + MO1-cd2ap	Fig. 7 from Kuusela et al., 2016
whole organism lethal (sensu genetics), abnormal	AB + MO1-cd2ap	text only from Hentschel et al., 2007

Phenotype of all Fish created by or utilizing MO1-cd2ap

Phenotype	Fish	Conditions	Figures
glomerular filtration disrupted, abnormal	AB + MO1-cd2ap	standard conditions	Fig. S8 from Schiffer et al., 2015 Fig. 3 from Hentschel et al., 2007
whole organism lethal (sensu genetics), abnormal	AB + MO1-cd2ap	standard conditions	text only from Hentschel et al., 2007
podocyte structure, abnormal	AB + MO1-cd2ap	standard conditions	Fig. 1 from Hentschel et al., 2007
whole organism decreased life span, abnormal	AB + MO1-cd2ap	standard conditions	Fig. S8 from Schiffer et al., 2015
pericardium edematous, abnormal	AB + MO1-cd2ap	standard conditions	Fig. 1 from Hentschel et al., 2007
whole organism nphs2 expression decreased amount, abnormal	WT + MO1-cd2ap	chemical treatment: XAV939	Fig. 7 from Kuusela et al., 2016
yolk syncytial layer edematous, abnormal	WT + MO1-cd2ap	chemical treatment: XAV939	Fig. 7 from Kuusela et al., 2016
protein poly-ADP-ribosylation increased occurrence, abnormal	WT + MO1-cd2ap	standard conditions	Fig. 7 from Kuusela et al., 2016
whole organism ctnnb1 expression increased amount, abnormal	WT + MO1-cd2ap	standard conditions	Fig. 7 from Kuusela et al., 2016
pronephric glomerular capillary distended, abnormal	WT + MO1-cd2ap	standard conditions	Fig. 7 from Kuusela et al., 2016
pronephric capsular space dilated, abnormal	WT + MO1-cd2ap	chemical treatment: XAV939	Fig. 7 from Kuusela et al., 2016
pronephric glomerulus dilated, abnormal	WT + MO1-cd2ap	chemical treatment: XAV939	Fig. 7 from Kuusela et al., 2016
proximal convoluted tubule dilated, abnormal	WT + MO1-cd2ap	chemical treatment: XAV939	Fig. 7 from Kuusela et al., 2016
whole organism ctnnb1 expression increased amount, abnormal	WT + MO1-cd2ap	chemical treatment: XAV939	Fig. 7 from Kuusela et al., 2016
pronephric glomerulus morphology, abnormal	WT + MO1-cd2ap	standard conditions	Fig. 7 from Kuusela et al., 2016
pericardium edematous, abnormal	WT + MO1-cd2ap	standard conditions	Fig. 7 from Kuusela et al., 2016
pericardium edematous, abnormal	WT + MO1-cd2ap	chemical treatment: XAV939	Fig. 7 from Kuusela et al., 2016
whole organism nphs2 expression decreased amount, abnormal	WT + MO1-cd2ap	standard conditions	Fig. 7 from Kuusela et al., 2016
pronephric glomerulus cystic, abnormal	WT + MO1-cd2ap	chemical treatment: XAV939	Fig. 7 from Kuusela et al., 2016
glomerular filtration disrupted, abnormal	WT + MO1-cd2ap + MO4-tp53	standard conditions	Fig. S4 from Yeo et al., 2015
podocyte development disrupted, abnormal	WT + MO1-cd2ap + MO4-tp53	standard conditions	Fig. S4 from Yeo et al., 2015
pronephric glomerular basement membrane increased permeability, abnormal	WT + MO1-cd2ap + MO4-tp53	standard conditions	Fig. S4 from Yeo et al., 2015
ocular blood vessel EGFP expression decreased amount, abnormal	lri500Tg + MO1-cd2ap	standard conditions	Fig. 4 from Tossidou et al., 2019
whole organism edematous, abnormal	lri500Tg + MO1-cd2ap	standard conditions	Fig. 4 from Tossidou et al., 2019

Citations