Morpholino
MO2-kdm6al
- ID
- ZDB-MRPHLNO-071029-3
- Name
- MO2-kdm6al
- Previous Names
-
- MO2-utxl1
- Target
- Sequence
-
5' - CCACCGACACTCGGCACGGCTTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-kdm6al
No data available
Phenotype
Phenotype resulting from MO2-kdm6al
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO2-kdm6al
1 - 5 of 27 Show all
Citations
- Van Laarhoven, P.M., Neitzel, L.R., Quintana, A.M., Geiger, E.A., Zackai, E.H., Clouthier, D.E., Artinger, K.B., Ming, J.E., Shaikh, T.H. (2015) Kabuki syndrome genes KMT2D and KDM6A: functional analyses demonstrate critical roles in craniofacial, heart, and brain development. Human molecular genetics. 24(15):4443-53
- Thieme, S., Gyárfás, T., Richter, C., Özhan, G., Fu, J., Alexopulou, D., Muders, M.H., Michalk, I., Jakob, C., Dahl, A., Klink, B., Bandola, J., Bachmann, M., Schröck, E., Buchholz, F., Stewart, A.F., Weidinger, G., Anastassiadis, K., and Brenner, S. (2013) The histone demethylase UTX regulates stem cell migration and hematopoiesis. Blood. 121(13):2462-2473
- Lan, F., Bayliss, P.E., Rinn, J.L., Whetstine, J.R., Wang, J.K., Chen, S., Iwase, S., Alpatov, R., Issaeva, I., Canaani, E., Roberts, T.M., Chang, H.Y., and Shi, Y. (2007) A histone H3 lysine 27 demethylase regulates animal posterior development. Nature. 449(7163):689-694
1 - 3 of 3
Show