header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070928-2
Morpholino Name: MO2-ryr1b
Target: ryr1b (1)
Sequence:
5' - ATTGGTTGACTCCTGATACTCAATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: morpholino designed to inhibit aberrant splicing of ryr1b transcript in mi340 mutants
TARGET LOCATIONS
View all 346 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ryr1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ryr1b
Expressed Gene Anatomy Figures
ryr1b Fig. 7 with image from Hirata et al., 2007
PHENOTYPE
Phenotype resulting from MO2-ryr1b
No data available

Phenotype of all Fish created by or utilizing MO2-ryr1b
No data available
Genome Resources:
CITATIONS (1)