Morpholino

MO1-amot

ID

ZDB-MRPHLNO-070906-14

Name

MO1-amot

Previous Names

None

Target

amot (1)

Sequence

5' - CCACTGACACAACTACCACCAAGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-amot

No data available

Phenotype

Phenotype resulting from MO1-amot

Phenotype	Fish	Figures
angiogenesis disrupted, abnormal	y1Tg + MO1-amot	Fig. 7 from Ernkvist et al., 2009
blood vessel endothelial cell migration disrupted, abnormal	y1Tg + MO1-amot	Fig. 1 from Ernkvist et al., 2009 Fig. 1 from Aase et al., 2007
cell migration involved in sprouting angiogenesis arrested, abnormal	y1Tg + MO1-amot	Fig. 1 from Aase et al., 2007
dorsal longitudinal anastomotic vessel aplastic, abnormal	y1Tg + MO1-amot	Fig. 1 from Aase et al., 2007
endothelial tip cell filopodium decreased amount, abnormal	y1Tg + MO1-amot	Fig. 1 from Aase et al., 2007
intersegmental vessel decreased length, abnormal	y1Tg + MO1-amot	Fig. 6 from Zheng et al., 2009
intersegmental vessel morphology, abnormal	y1Tg + MO1-amot	Fig. 7 from Ernkvist et al., 2009
intersegmental vessel truncated, abnormal	y1Tg + MO1-amot	Fig. 1, Fig. 6 from Ernkvist et al., 2009 Fig. 1, text only from Aase et al., 2007
intersegmental vessel endothelial tip cell positional polarity, abnormal	y1Tg + MO1-amot	Fig. 6 from Zheng et al., 2009
primordial hindbrain channel dilated, abnormal	y1Tg + MO1-amot	Fig. 1 from Aase et al., 2007
primordial midbrain channel dilated, abnormal	y1Tg + MO1-amot	Fig. 1 from Aase et al., 2007

Phenotype of all Fish created by or utilizing MO1-amot

Phenotype	Fish	Conditions	Figures
cell migration involved in sprouting angiogenesis arrested, abnormal	y1Tg + MO1-amot	standard conditions	Fig. 1 from Aase et al., 2007
intersegmental vessel morphology, abnormal	y1Tg + MO1-amot	standard conditions	Fig. 7 from Ernkvist et al., 2009
intersegmental vessel decreased length, abnormal	y1Tg + MO1-amot	standard conditions	Fig. 6 from Zheng et al., 2009
angiogenesis disrupted, abnormal	y1Tg + MO1-amot	standard conditions	Fig. 7 from Ernkvist et al., 2009
primordial hindbrain channel dilated, abnormal	y1Tg + MO1-amot	standard conditions	Fig. 1 from Aase et al., 2007
blood vessel endothelial cell migration disrupted, abnormal	y1Tg + MO1-amot	standard conditions	Fig. 1 from Ernkvist et al., 2009 Fig. 1 from Aase et al., 2007
intersegmental vessel truncated, abnormal	y1Tg + MO1-amot	standard conditions	Fig. 1, Fig. 6 from Ernkvist et al., 2009 Fig. 1, text only from Aase et al., 2007
intersegmental vessel endothelial tip cell positional polarity, abnormal	y1Tg + MO1-amot	standard conditions	Fig. 6 from Zheng et al., 2009
dorsal longitudinal anastomotic vessel aplastic, abnormal	y1Tg + MO1-amot	standard conditions	Fig. 1 from Aase et al., 2007
endothelial tip cell filopodium decreased amount, abnormal	y1Tg + MO1-amot	standard conditions	Fig. 1 from Aase et al., 2007
primordial midbrain channel dilated, abnormal	y1Tg + MO1-amot	standard conditions	Fig. 1 from Aase et al., 2007
eye decreased size, abnormal	axin1^tm213/+ + MO1-amot + MO1-amotl1 + MO1-amotl2a (TU)	standard conditions	Fig. 2 from Li et al., 2012
eye agenesis, abnormal	axin1^tm213/tm213 + MO1-amot + MO1-amotl1 + MO1-amotl2a (TU)	standard conditions	Fig. 2 from Li et al., 2012
intersegmental vessel decreased length, abnormal	y1Tg + MO1-amot + MO1-amotl1	standard conditions	Fig. 6 from Zheng et al., 2009
intersegmental vessel endothelial tip cell positional polarity, abnormal	y1Tg + MO1-amot + MO1-amotl1	standard conditions	Fig. 6 from Zheng et al., 2009
intersegmental vessel blood vessel endothelial cell cellular adhesivity intersegmental vessel blood vessel endothelial cell, abnormal	y1Tg + MO1-amot + MO1-amotl1	standard conditions	Fig. 6 from Zheng et al., 2009
cell-cell adhesion disrupted, abnormal	y1Tg + MO1-amot + MO1-amotl1	standard conditions	Fig. 6 from Zheng et al., 2009
intersegmental vessel morphology, abnormal	y1Tg + MO1-amot + MO1-plekhg5b	standard conditions	Fig. 7 from Ernkvist et al., 2009
angiogenesis disrupted, abnormal	y1Tg + MO1-amot + MO1-plekhg5b	standard conditions	Fig. 7 from Ernkvist et al., 2009

Citations