header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070906-11
Morpholino Name: MO1-il20ra
Target: il20ra (1)
Previous Name: MO1-crfb8

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACAGGTCGATAAAACTACATCCATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-il20ra No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-il20ra No data available
PHENOTYPE
Phenotype resulting from MO1-il20ra
No data available

Phenotype of all Fish created by or utilizing MO1-il20ra
No data available
OTHER MO1-il20ra MORPHOLINO PAGESNo links to external sites
CITATIONS (2)