Morpholino

MO1-raptor

ID
ZDB-MRPHLNO-070813-1
Name
MO1-raptor
Previous Names
None
Target
Sequence
5' - ATGGATGGATGGATGCTCACCTATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-raptor
Expressed Gene Anatomy Figures
urb1 Fig. 5 from He et al., 2017
Phenotype
Phenotype resulting from MO1-raptor
Phenotype Fish Figures
digestive system urb1 expression decreased amount, abnormal s854Tg + MO1-raptor Fig. 5 from He et al., 2017
gut decreased size, abnormal WT + MO1-raptor Fig. 10 from Makky et al., 2007
gut endothelial cell decreased size, abnormal WT + MO1-raptor Fig. 10 from Makky et al., 2007
gut endothelial cell morphology, abnormal WT + MO1-raptor Fig. 10 from Makky et al., 2007
liver DsRed expression amount, ameliorated cq32Tg; cq33Tg + MO1-raptor Fig. 5 from He et al., 2017
liver DsRed expression decreased amount, abnormal cq32Tg + MO1-raptor Fig. 5 from He et al., 2017
liver decreased size, abnormal cq32Tg + MO1-raptor Fig. 5 from He et al., 2017
liver size, ameliorated cq32Tg; cq33Tg + MO1-raptor Fig. 5 from He et al., 2017
pancreas EGFP expression amount, ameliorated cq33Tg; jh1Tg + MO1-raptor Fig. 5 from He et al., 2017
pancreas EGFP expression decreased amount, abnormal jh1Tg + MO1-raptor Fig. 5 from He et al., 2017
pancreas decreased size, abnormal jh1Tg + MO1-raptor Fig. 5 from He et al., 2017
pancreas size, ameliorated cq33Tg; jh1Tg + MO1-raptor Fig. 5 from He et al., 2017
whole organism cytosolic large ribosomal subunit amount, ameliorated cq33Tg + MO1-raptor Fig. 6 from He et al., 2017
whole organism cytosolic large ribosomal subunit decreased amount, abnormal WT + MO1-raptor Fig. 6 from He et al., 2017
whole organism cytosolic ribosome amount, ameliorated cq33Tg + MO1-raptor Fig. 6 from He et al., 2017
whole organism cytosolic ribosome decreased amount, abnormal WT + MO1-raptor Fig. 6 from He et al., 2017
whole organism cytosolic small ribosomal subunit decreased amount, abnormal WT + MO1-raptor Fig. 6 from He et al., 2017
Phenotype of all Fish created by or utilizing MO1-raptor
Phenotype Fish Conditions Figures
retinal inner nuclear layer cell population proliferation decreased occurrence, abnormal AB + MO1-raptor perforation: retina Fig. 2,  Fig. 5 from Zhang et al., 2019
Muller cell cell population proliferation decreased occurrence, abnormal AB + MO1-raptor perforation: retina Fig. 5 from Zhang et al., 2019
eye photoreceptor cell cell population proliferation decreased occurrence, abnormal AB + MO1-raptor perforation: retina Fig. 5 from Zhang et al., 2019
amacrine cell cell population proliferation decreased occurrence, abnormal AB + MO1-raptor perforation: retina Fig. 5 from Zhang et al., 2019
regenerating tissue cell population proliferation decreased occurrence, abnormal AB + MO1-raptor perforation: retina Fig. 2,  Fig. 5 from Zhang et al., 2019
gut decreased size, abnormal WT + MO1-raptor standard conditions Fig. 10 from Makky et al., 2007
whole organism cytosolic large ribosomal subunit decreased amount, abnormal WT + MO1-raptor control Fig. 6 from He et al., 2017
whole organism cytosolic ribosome decreased amount, abnormal WT + MO1-raptor control Fig. 6 from He et al., 2017
whole organism cytosolic small ribosomal subunit decreased amount, abnormal WT + MO1-raptor control Fig. 6 from He et al., 2017
gut endothelial cell morphology, abnormal WT + MO1-raptor standard conditions Fig. 10 from Makky et al., 2007
gut endothelial cell decreased size, abnormal WT + MO1-raptor standard conditions Fig. 10 from Makky et al., 2007
liver decreased size, abnormal cq32Tg + MO1-raptor standard conditions Fig. 5 from He et al., 2017
liver DsRed expression decreased amount, abnormal cq32Tg + MO1-raptor standard conditions Fig. 5 from He et al., 2017
whole organism cytosolic large ribosomal subunit amount, ameliorated cq33Tg + MO1-raptor heat shock Fig. 6 from He et al., 2017
whole organism cytosolic ribosome amount, ameliorated cq33Tg + MO1-raptor heat shock Fig. 6 from He et al., 2017
pancreas decreased size, abnormal jh1Tg + MO1-raptor standard conditions Fig. 5 from He et al., 2017
pancreas EGFP expression decreased amount, abnormal jh1Tg + MO1-raptor standard conditions Fig. 5 from He et al., 2017
digestive system urb1 expression decreased amount, abnormal s854Tg + MO1-raptor standard conditions Fig. 5 from He et al., 2017
liver DsRed expression amount, ameliorated cq32Tg; cq33Tg + MO1-raptor heat shock Fig. 5 from He et al., 2017
liver size, ameliorated cq32Tg; cq33Tg + MO1-raptor heat shock Fig. 5 from He et al., 2017
pancreas EGFP expression amount, ameliorated cq33Tg; jh1Tg + MO1-raptor heat shock Fig. 5 from He et al., 2017
pancreas size, ameliorated cq33Tg; jh1Tg + MO1-raptor heat shock Fig. 5 from He et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.