header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070730-4
Morpholino Name: MO2-mef2ca,mef2d
Targets: mef2ca (1), mef2d (1)
Previous Names: MO2-mef2c+mef2d, MO2-mef2c/d, MO2-mef2ca+mef2d

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCTTTTTCCTCCCCATGACTTCTGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Perfect match to mef2ca sequence, very close to mef2d, predicted to knock down translation of both genes.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-mef2ca,mef2d No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-mef2ca,mef2d
Expressed Gene Anatomy Figures
mef2ca Fig. S2 with image from Hinits et al., 2007
smyhc1 Fig. S3 with image from Hinits et al., 2007
tnnc2 Fig. S4 with image from Hinits et al., 2007
PHENOTYPE
Phenotype resulting from MO2-mef2ca,mef2d
No data available

Phenotype of all Fish created by or utilizing MO2-mef2ca,mef2d
No data available
OTHER MO2-mef2ca,mef2d MORPHOLINO PAGESNo links to external sites
CITATIONS (2)