header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070730-1
Morpholino Name: MO1-mef2ca
Target: mef2ca (1)
Previous Name: MO1-mef2c

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTTCCTTCCTCTTCCAAAAGTACAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mef2ca No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mef2ca
Expressed Gene Anatomy Figures
elna Fig. S8 with image from Hinits et al., 2012
mef2ca Fig. S1 with imageFig. S2 with image from Hinits et al., 2007
myhz1.1 Fig. S4 with image from Hinits et al., 2007
myl7 Fig. S6 with image from Hinits et al., 2012
smyhc1 Fig. S3 with image from Hinits et al., 2007
tnnc2 Fig. S4 with image from Hinits et al., 2007
PHENOTYPE
Phenotype resulting from MO1-mef2ca
No data available

Phenotype of all Fish created by or utilizing MO1-mef2ca
OTHER MO1-mef2ca MORPHOLINO PAGESNo links to external sites
CITATIONS (3)