ZFIN ID: ZDB-MRPHLNO-070724-1
Morpholino Name: MO2-pax2a
Target: pax2a (1)
Sequence:
5' - CATGGGATAGCAAAGGAAGGAAAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The published version is missing a bp, the correct sequence is displayed.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-pax2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-pax2a No data available
PHENOTYPE
Phenotype resulting from MO2-pax2a
No data available

Phenotype of all Fish created by or utilizing MO2-pax2a
No data available
OTHER MO2-pax2a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)