Morpholino

MO1-mtor

ID
ZDB-MRPHLNO-070629-3
Name
MO1-mtor
Previous Names
  • MO1-frap1
Target
Sequence
5' - GGTTTGACACATTACCCTGAGCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mtor
Expressed Gene Anatomy Figures
fabp2 Fig. 7 from Makky et al., 2007
fabp10a Fig. 4 from Wang et al., 2018
urb1 Fig. 5 from He et al., 2017
Phenotype
Phenotype resulting from MO1-mtor
Phenotype Fish Figures
digestive system urb1 expression decreased amount, abnormal s854Tg + MO1-mtor Fig. 5 from He et al., 2017
gut decreased size, abnormal WT + MO1-mtor Fig. 7 from Makky et al., 2007
gut endothelial cell morphology, abnormal WT + MO1-mtor Fig. 7 from Makky et al., 2007
gut epithelium morphology, abnormal WT + MO1-mtor Fig. 7 from Makky et al., 2007
intestine decreased size, abnormal WT + MO1-mtor Fig. 7 from Makky et al., 2007
liver DsRed expression amount, ameliorated cq32Tg; cq33Tg + MO1-mtor Fig. 5 from He et al., 2017
liver DsRed expression decreased amount, abnormal cq32Tg + MO1-mtor Fig. 5 from He et al., 2017
liver decreased size, abnormal cq32Tg + MO1-mtor Fig. 5 from He et al., 2017
Fig. 7 from Makky et al., 2007
liver size, ameliorated cq32Tg; cq33Tg + MO1-mtor Fig. 5 from He et al., 2017
pancreas EGFP expression amount, ameliorated cq33Tg; jh1Tg + MO1-mtor Fig. 5 from He et al., 2017
pancreas EGFP expression decreased amount, abnormal jh1Tg + MO1-mtor Fig. 5 from He et al., 2017
pancreas decreased size, abnormal jh1Tg + MO1-mtor Fig. 5 from He et al., 2017
pancreas size, ameliorated cq33Tg; jh1Tg + MO1-mtor Fig. 5 from He et al., 2017
Phenotype of all Fish created by or utilizing MO1-mtor
Phenotype Fish Conditions Figures
gut decreased size, abnormal WT + MO1-mtor standard conditions Fig. 7 from Makky et al., 2007
gut epithelium morphology, abnormal WT + MO1-mtor standard conditions Fig. 7 from Makky et al., 2007
intestine decreased size, abnormal WT + MO1-mtor standard conditions Fig. 7 from Makky et al., 2007
liver decreased size, abnormal WT + MO1-mtor standard conditions Fig. 7 from Makky et al., 2007
gut endothelial cell morphology, abnormal WT + MO1-mtor standard conditions Fig. 7 from Makky et al., 2007
liver DsRed expression decreased amount, abnormal cq32Tg + MO1-mtor standard conditions Fig. 5 from He et al., 2017
liver decreased size, abnormal cq32Tg + MO1-mtor standard conditions Fig. 5 from He et al., 2017
pancreas decreased size, abnormal jh1Tg + MO1-mtor standard conditions Fig. 5 from He et al., 2017
pancreas EGFP expression decreased amount, abnormal jh1Tg + MO1-mtor standard conditions Fig. 5 from He et al., 2017
digestive system urb1 expression decreased amount, abnormal s854Tg + MO1-mtor standard conditions Fig. 5 from He et al., 2017
liver DsRed expression amount, ameliorated cq32Tg; cq33Tg + MO1-mtor heat shock Fig. 5 from He et al., 2017
liver size, ameliorated cq32Tg; cq33Tg + MO1-mtor heat shock Fig. 5 from He et al., 2017
pancreas EGFP expression amount, ameliorated cq33Tg; jh1Tg + MO1-mtor heat shock Fig. 5 from He et al., 2017
pancreas size, ameliorated cq33Tg; jh1Tg + MO1-mtor heat shock Fig. 5 from He et al., 2017
caudal fin melanocyte area, ameliorated bace2hu3332/hu3332 + MO1-mtor (AB) standard conditions Fig. 4 with image from Zhang et al., 2018
caudal fin melanocyte amount, ameliorated bace2hu3332/hu3332 + MO1-mtor (AB) standard conditions Fig. 4 with image from Zhang et al., 2018
whole organism length, ameliorated dstykcq75/cq75 + MO1-mtor (AB) chemical treatment: torin 1 Fig. 9 with image from Sun et al., 2020
notochord vacuole area, ameliorated dstykcq75/cq75 + MO1-mtor (AB) chemical treatment: torin 1 Fig. 9 with image from Sun et al., 2020
liver fabp10a expression amount, ameliorated lars1bcq68/cq68 + MO1-mtor standard conditions Fig. 4 from Wang et al., 2018
liver size, ameliorated lars1bcq68/cq68 + MO1-mtor standard conditions Fig. 4 from Wang et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.